Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17087  (registered. 2003)
Contig Information
Length 934 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_28007 [Oryza sativa Indica Group]
Score 443
Evalue 5.58296e-42
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17087
GATAAAGTTTCACCGTGACTCAGATCATGATAATCAATACAAGTGGAAAATATATTTATCTAAAGAACATCTAACTACATGAGTTCAGATTGTTGTTTCC
GCTACAGGTTTCAAGTTTCAAATGTCATACAACATCCACGCATTTACAATTCACACATTATAAACAAAGGCAGTGCTGGTGAAACCGCTGCACCCTTCTT
TTTCTGTATCAACTCAGCATACACAGAATTCTCCAAGAAATACCCAAACACCCGGGGGACCAAACAAGGCTTCACAAACAATGTGGCCGCAATGACTTCA
AACCAGGCTCAACGACTAATTTGCAGATAACTAGAACTCAAGGCTTCGATGAGAAGAGGTTGGGGTAGGAGAACGGATCGTCCTCCAACGACGTTGATCT
CTGAGGCACATGAGATGGCGCATAACCCTCAAGGTCATTGGAAAAAGAGTCCTGATGATCAAATACCGGTTTCTGCTCAGTTTGATGATGACTTTCCTTT
TGGCTACCATCACTGTGGCTCTCATAAACCCTAGTGTTCTTCTTTAGATCGGCAATGCACAGTTTCGCAAGGTTTGCAGCAGCACGTGCTGCCGATGCAG
CTCGCTCTGCTGAATCAGCAGCTGTTTGCGCAGCTGAAACCACGCCATCCATATCAATATTTTCCCCGCTCTCTATAGGAGAGATCGAATGCACCTGTTC
TGGACGCTTCGAGAACATGTTGAAATCTTTGGGTGTTTGGGGAGCAGTCACTTCATCAACTGACCTTGTGAAGAATTCTTGCTCTGTTGGCTTCACTTGA
GGAGAATTTAAGGGAATCGAGTCACTTCTCTCCATAGAAGAAGCAGAAGCAAATGGTGGGGGAGAGACAAAAGGAACAAATTGCTTCTTTTCATCTGGCA
AAGCTGGCATCCTTGGCTGAGCAAATTGTGGAGA
page-top