Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17073  (registered. 2003)
Contig Information
Length 649 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_30128 [Oryza sativa Indica Group]
Score 599
Evalue 2.26133e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17073
TTTTTTTTTTACTCCAAATTGATCTTTGTACTTCTATATATATGCCCGCGAGACTCAAGCAATACAACAACTATTCCATCAAATCCCTCTCTCCCTTCTA
ACTTTGACATCCCAGTTTCACGATAGAAATCAGTCTGCACAGTCATTTTATTTTGTTTCACGACACACAACACACCGCGCGCACGCGGACACGCTGGCAT
GCACGCACGCAGCTCCAGTCCAAGCATGGCTTGAATCCCTAGCAACAGTAGCAGCCTGGATGTCTAGAGGTTGAACATGACCTTGATGGCGTCGCGGCCG
CGCGCGCTGACCTCGAAGGCCTCCTCCACCTCCCCCTGCGAGAAGCCGAACCTGTGCGTGATGAGCGGCTTCACGTCGATCTTGCCGCTCCGCAGGAACT
CGAGGCACAGCGGCCACGTGTCCTTGTAGCGGAAGATCCCCACCACGTCCACCTCCCGGATCGCCGCCGACGTCAGCGGCACCGTCATCTCGTTGTGCCC
CATCCCCACCAGGCACACCCTCCCGCCCGGCCGCGTCGCCTCCAGCGCGGTCGACATCGTCTTGCTGAACCCGGCGCAGTCCAGGCTCACGTCGATGTCG
CCTCCCATCGCCGCCTGGATGCGCTCGATCTCCCCCGNGAGGTCCTCCG
page-top