Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17031  (registered. 2003)
Contig Information
Length 1334 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsI_32217 [Oryza sativa Indica Group]
Score 480
Evalue 3.54259e-47
Total Hit Count 489
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17031
CAAAATTTAATACAGCAGGGAAATCCTGTGAGATAAACCCCATATATCATCCACAACACTCCACAGGACGCATCATCCATGGCAACAAGGGACGACAATT
TCTTTTCAGACAAAACTATACAGCCAAAAGAAAAAAGGATTTGCACTTCTGGGATTTATTTCCTATTTATTGCTGTGTTTGCCCCCTTACTGCTTTTGTA
ATGCGCTTTTCAAGTGCAGCCATCATGTCCGACCTAGACAAACAAAATAGTCCGACTCTGGAAATGTAACCCCGCTGTACATACATGGTCCATCTATCAC
GGGATATCCTGCCCGTGGTCAAACAGACAATCCCTTCCAATCGATTCTCCGGCAATAACAAGCAGTTTTGTTTCGGCACTGGACCTAATTTGAAGGTGGT
GGGCCTCGGTGGAGTAACCATGCCGCCCAATCATTGCGTCTTCGGACATTATTTCCCTGCACTTCCAACAACTCAGAGCCCCGGATAGAATCTAGTATAT
AGTTGGTATCTATTCCCAACATTGTGAACCTGGTCAACATAGGAAATGAAGCGATTAGGTCAATAGGCACCCATCCTTGATCATCCATACGTTCCCTCAA
GTATGTGTCGTGGCAAAGATTATTAGTGCTAAAATAGTGCTCGATCTGCAGCTGAATGTCACGTTGGAGATTAATTTGATCTTGCTGAAACGCCAATGGC
TGCATTGGCGGCCGGATAAGATGCATGTTTTGAAACTGCTGCTCAACTTGTGTGACATAGTAAGGATAGGAGGCTTGTAAATCAGCAGGATACGGAATGG
GTTGAACGTATGGCACAAAAGGTTGTGGCACCATGAAATGGGCAGCAGCAGGTGATGGCGGTGGTGGTCGTTGAAATGGTCCAGGCTGGTAGTAGCCCGG
CTGCTGCTGCTGCACTGGCAATGCACGGGAATAGTTCCTTGGTGAGAAATTACTCCCTCTTTCATGGTCACGGCGATTCCGACCACCACGAGCACCAAAG
CCATTACTATTACCACTACCATGTCGGGCATTATTGTTCCAGTGGCCGCTGCCACTACCGCCGTTATATCTGTTGCCCCCATCACCACTGCCGGTGGCAT
TGTTGTAGCTGCCACCACCACGACCGTTGCCATTCCAATTGTTACTGCCGAACACTCTCCTACTATTGTCAATACCACTGCCACCAATGGCGCCGCTATG
AACACTAGAGTTCAAGTTGCTGCCACCATTAAGACCCCCATCATTCCAGTTACCGTCACCACCACTGCTGCTGTTCCCATCACTACTGTAATTACCAGTG
CTCTGGCTATGAGTGCTCACATTGCCACCGCCGC
page-top