Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17019  (registered. 2003)
Contig Information
Length 811 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|19569141|gb|AAL92029.1|AF486280_1 cytosolic 6-phosphogluconate dehydrogenase [Oryza sativa] >gi|7363280|dbj|BAA93024.1| putative phosphogluconate dehydrogenase [Oryza sativa Japonica Group] >gi|113594626|dbj|BAF18500.1| Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|125595798|gb|EAZ35578.1| hypothetical protein OsJ_019061 [Oryza sativa (japonica cultivar-group)] >gi|215686886|dbj|BAG89736.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1166
Evalue 6.32458e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17019
CTCGCATCCGCATCGCACCGCAATTGTCTTCCTTCCTCGACGGACGCACGCACGCAGATCTCATCCAAGGCAGGCAGGTACAAGATGGCTCTCACCAGAA
TTGGTCTTGCTGGCCTCGCCGTCATGGGGCAGAACCTTGCCCTCAACATTGCAGAGAAAGGCTTCCCCATCTCTGTCTACAACAGGACCACCTCCAAGGT
CGATGAGACTGTCCAGCGCGCCAAGCTAGAAGGAAACCTTCCCCTGTACGGTTTCCATGACCCTGCATCCTTCGTCAACTCCATTCAGAAGCCACGCGTC
GTCATCATGCTTGTCAAGGCTGGCGCACCAGTTGACCAGACCATCGCCACGCTCGCAGCACACCTGGAGCAGGGCGACTGCATCGTTGATGGAGGAAACG
AGTGGTATGAGAACACAGAAAGGAGGGAGAAGGCGATGGAGGAGCGTGGACTCCTCTACCTCGGGATGGGTGTTTCCGGAGGAGAGGAGGGTGCCCGCCA
TGGCCCCTCCATGATGCCTGGAGGCTCGCTGGAGGCGTACCAGTACATTGAAGACATTCTTCTCAAGGTGTCTGCTCAGGTCCCTGACAGCGGCCCGTGT
GTCACATACATTGGGAAGGGTGGATCCGGAAACTTTGTCAAGATGGTTCACAATGGTATTGAGTACGGTGACATGCAGCTGATCGCTGAGGCGTATGACG
TTCTCAAGTCGGTTGGCAAGCTCACAAACGGTGAGCTGCANCANGTTTTCACCGAGTGGAACAANGGTGANCTCCTCANTTTCTTGGTCNANATCACTGC
TGATATATTCA
page-top