Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17017  (registered. 2003)
Contig Information
Length 638 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195622750|gb|ACG33205.1| 60S acidic ribosomal protein P3 [Zea mays] >gi|195654339|gb|ACG46637.1| 60S acidic ribosomal protein P3 [Zea mays]
Score 267
Evalue 6.86346e-22
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17017
AACTGGTTGCTATCGGCCGCATCCCACCACCAAGCTCCAGACGCCTCCTCCTCCTCCCCCGCCGCCGCCGCACGCTCCAGAGACCGCAGGCATGGGCGTC
TTCACCTTCGTGTGCCGCGACTCCGGCGCCGAGTGGTCGGCCAAGCAGCACAAGGGCGAGCTCGAGGCCTCCGCCGCCACGCCCTACGACCTGCAGCGCC
AGCTCGTCTCCGCCGCCTGCGCCGAGGACAAGTCCGGCGGCGTCCAGTCCTCCTTCACCATGGTCTCCCCCAATTCCGCCATCTTCCAGGTGGTCATTGG
TGGTGCCTCTGCTGGTCCGATCGGTGGTGGTGCTGGTGGTGGTGGTGCCGCTGCATCAGGTGGAGCTGCCGCAGAGGCCCCCAAGGCTGAGGAGAAGAAG
GAAGAGGAGAAGGAGGAGAGCGAGGATGACCTTGGCTTCTCCCTCTTCGATTAGATCTTCTTTACCCTGTTGCTCGCCAGAAATGACATTGTCCTATTGC
CGCAGTAATTTTGATGCCATGCCCACAGGGTTTGTGAACCTGCCTAGTTTGATTGTTCAAGGGATGTATGTGTTACTTTCTGTTCATGTGAGGATTTGGT
TATGTTATTATGCAGCATCGAATATCCCAAAAAAAAAA
page-top