Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17005  (registered. 2003)
Contig Information
Length 1301 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 1
Homology (BLAST) Top Hit hypothetical protein OsI_13064 [Oryza sativa Indica Group]
Score 1226
Evalue 1.46667e-132
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17005
GGGTGATATAAGCACCATACCAGAGGTGAACAGTCCAGAGTTGTCAGAATGCAATCTTTACGGCTATATCCACCAATATATCCATTTGCTCGAAAGTGAT
GTCCGAGTAGATGTTCTTGAAGCACTAAACGAGAAGATAAGAAAGCGTTTCAAGACACCTAAATTGACAAATAGCAACTTTGCGAAGATCTGTAAGCATG
CTTCTCTGTCATGGTGCCGTTGTATACTCATCAAATTGGCCTCAATCACCCCGCTGCCTGAATCTATGGACACAGACAATCAGCCTGTTCCATTATCCAA
TGGCCTTCTGTTGTACGTTGATCTGCAACCTGATGAGCTCCTTATCTCATCCCCTGATGGGCCTACTCAATTCAAAGGTCTTGACATGAATTGGTTTGAG
ACACTCGCTAGAATTAAAAACATTCCGATCAGACAGACATCCGAAGATAACATGGAGACTGCAGTTACTGTAATGAAGAGCACTTACAACTTTTATCGGG
ACAGTTCTTGTGGAACATTTCCCTCAGGTATTAATCTCTACACAGTAACCCCATCCCAGGCATCTGTTGAAGGGTTATTACAGCAAGCCCCCGGTATAGT
TGACACCCTTGACCTAAGCATCCCAAGGAAGCTCCTTCTGTGGGTATATACATTAGTTCACGGTCGATATTGCAACATATCCGCTGTCGTAAAGTACTGC
GATGAGATGAAGGCAAGAAATAAAAGAGGAACCCTAACGGCGGCAGCTTCATCACAAGTCACGCCTCCAGCACCGCACAGCTCTGTTTCTTCTCTGGTCA
CCTCCAAAGAAAAGAGTGCGCATACCGTGTCCAGTGAAGTTCAAGAAGCAAATGCCTCTGCTCCAGTAGCAGCCACTGTTCCTCTCCACCAAGAAGCAGA
GGGCAGCGCATCGCTGATTGCCACCGAGGCACAGAAACCCAGCACCGCGGCATCTCAACTGTCGCGCAGCAGCTCATCTAGGACAATGGAAAGTGCTCCG
GATGGCGGTCAAGGCAATGCCGGTGCAGCTTGATTGTACATCATGCTTCTGTACACCCATGTGAGCTCCGCGGATGGTCATGAGTTCTGATTAGATTGAA
GGCTTCTTCCCTTCCAGCAGAAATATGATGTACTTACTGCAGTTGTAGCAGGACTAGGTCTGATGCCTTTCCTGGTGTATAAAACTAACATTGTATTAGA
AGCTAATGTAACACTAAGGACATGCAAGTTCGGTGAGTGTTTGGTTGTAGCCAGAGTTGTGATGCGCCACACCTTTTTAACATTTTACCCCAAAAAAAAA
A
page-top