Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17004  (registered. 2003)
Contig Information
Length 281 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708104|gb|ACF88136.1| unknown [Zea mays]
Score 110
Evalue 0.000519912
Total Hit Count 386
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17004
GCCGAATTCGGCACGAGGCCCGAGCCCTTCACCTTGGCAGTCTGGTACCCGGGGTACCACTGGCATATTCTCTTCCCGGTCTTGGCGAGGGGGCAAGAAA
CAGGCGACCGACCGGCCAAAACAAGCTCGCTCGGCGCTGCTTCCGAATCTGACCCCGTCGGCTCCTCCTTCCTCATCCAGGGATCAGAGGGGAGGAAGAA
GGGGGACGCCTCGCCATGAAGGCGCTCATCCTCGTCGGGGGCTTCGGGACCCGCCTACGGCCTCTCACGCTCAGCTTCCCC
page-top