Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16955  (registered. 2003)
Contig Information
Length 1467 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit Hypothetical protein COLAER_01671 [Collinsella aerofaciens ATCC 25986] >gi|139439470|ref|ZP_01772902.1| Hypothetical protein COLAER_01925 [Collinsella aerofaciens ATCC 25986] >gi|139439882|ref|ZP_01773247.1| Hypothetical protein COLAER_02284 [Collinsella aerofaciens ATCC 25986] >gi|133774810|gb|EBA38630.1| Hypothetical protein COLAER_02284 [Collinsella aerofaciens ATCC 25986] >gi|133775023|gb|EBA38843.1| Hypothetical protein COLAER_01925 [Collinsella aerofaciens ATCC 25986] >gi|133775241|gb|EBA39061.1| Hypothetical protein COLAER_01671 [Collinsella aerofaciens ATCC 25986]
Score 363
Evalue 3.18851e-37
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16955
TACACTGATAAGGGATGTATGGATTCTCGAGAAGAGAGGAGCCGTGGTGGCCCCCCCCCGGACCGCCCGGATCCCACGAGTGAATAGAAAGTTAGATCTA
CATGGGATCTCACCTGAATCGCCCCATCTATCCTCCTGAGGAGAAGTTTGTTTGGTTTCAAACTCCGATTCAAACAGGAGGAGTACGCCATGCTAATGTG
CCTTGGATGATCCACATCTTCGGGTCAGGCGCTGATGAGCACATTGAACTATCCATGTGGCTGAGAGCCCTCACAGCCCAGGCACAACGACGCAATTATC
AGGGGCGCGCTCTACCACTGAGCTAATAGCCCGTCGCGCGGGCCTCCCAAAGGGAGGCCTGCTACGCCAAAAGCGAGAAAAACTCCATCCCTTTCCTTTT
GACATCCCCATGCCGCCACACCACAGGGGGGACATGGGGACGCCAAAAAAGGGATCCTATCACTATCAACTAATTTGTTACGACCTAGGATAATAAGCTC
ATGAGCTTGGTCTTACTTCACCCTAAACGAAAGAAGACTTCCATATCCAAGTTTAGCTCAGACGTAGCTGCCTTCTTTTTGGGCGTGAAGAAGTGTCAAA
CCAAAATACCCAATAAGCATAAGCATTAGCTCTCCCTGAAAAGGAGGTGATCCAGCCGCACCTTCCAGTACGGCTACCTTGTTACGACTTCACTCCAGTC
GCAAGCCTAGCCTTAGGCATCCCCCTCCTTACGGTTAAGGGTAATGACTTCAAACATGGCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGG
GAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGGACGGGTTTTTG
GAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGGCCTCATCCTC
TCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTGGCAACTAAACACGAGGGTTGCGCTCGTTGCGAGACTTAACCCAACAC
CTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCGAGGGCACCCCTCTCTTTCAAGAGGATTCGCGGCCCTCGTGCCGAATTCG
GCACGAGGCCTCGTGCCGTGTGAGGCCTACACCTGTGCAGCGGCATGCCATTCCGATTGTCATTGGAGGCAGGGATCTGATGGCCTGCGCTCAGACTGGG
TCTGGGAAGACAGCTGCTTTTTGTTTCCCGATCATCAGTGGGATCCTTAAGTCAAGGCCACCACAGAGGCCTAGAGCTAGGACTGCATTTCCTCTTGCTC
TGATATTATCTCCTACTCGCGAGCTATCCGTCCAAATTCATGAAGAAGCAAAGAAATTTGCATACCA
page-top