Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7038  (registered. 2012)
Contig Information
Length 978 bp
Clones alternative view 409 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_SH - 28
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 21
Wh_VABA Shoot with ABA treatment 27
Wh_VHS Shoot with heat shock treatment 36
Wh_VWD Shoot grown with dessication 27
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 11
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 23
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 18
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 21
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XE Seedling, infected with leaf rust 36
WH_XF Seedling, infected with leaf rust 45
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 17
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 23
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 11
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290875537|gb|ADD65763.1|| putative carbonic anhydrase [Triticum turgidum subsp. durum x Secale
Score 358
Evalue 7.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7038
AAAGCAGTGCCAGACACCAGATGGAGAACCGTAAGGACTTTTTTTTTTAAAAGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTT
TGATCACAGGACGATCAAATTATGCATCACATGGTAGTACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGGTTCTATTGCTTATGGCGAATTCACAT
CGGGCCATCCCGGCATCCAGTACTGGAAAACAACGAGTACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGATATCTTGATATATGTACGCG
TTTGCATTCGCATGTATATATAGGAGTTAACCGCTGGGGAAGATTTACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAATGGCCGCCGACGA
GCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAACGGGTAGGTCAGGAGGTTCTGCAGGGACACGTTCACTGCCTCCTTTTCGAGGACGGTGCACTG
GTCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCG
CCATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGG
CCGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAGGGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGAC
CGATGGGCACACACGCGAGTCGGCGCACGCGAACACCATGTACTTGGGCGCCTGGCCGGCCTTCCTTGGCTCTGGTAGCCGTTTCTCNNNCTCCCTCTCC
GGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTANNCCCCTATCCTACCATCGAAAGTTGATAGGGCAG
page-top