Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7034  (registered. 2012)
Contig Information
Length 825 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1373150|gb|AAB02197.1|| soluble starch synthase [Triticum aestivum]
Score 338
Evalue 4.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7034
TTTTTTTTTTGACCAAAAGAAAAACAGCAGCAAAGATAGAATTATCCAACAGGTCAAATATTTGTCAGCTAAGGACAAGACAACATACACAGAATGCAAC
AAACTTCACAATCGCTAAGGCTAAAGAGTCACCAGTTGGTTTCTGATTTCAGCTGTAACACGGACAGAGAGGCTGCCATCTGAGTGGTGCTTTGCTGTTA
ACCATCCTGCAGCACATCCCTTCCTTATTCCCCAAAACTGTAACTGTCATCCACCCGAAGCTGTCACCGCCGCAGCAGCACAGCCGTCATCTACTCTCGA
ACCGGCGGACCAAGCAAGCAGGCGCATTGCGACTCTACTGTAGCAGGACAACGCAATGTACAGGGGTATCCTTCCGGGCCGCGGAAGGATGAGGAACATG
TCTTCAGAGCTCAAGGAGACCCGCGCTTCGACCTCCCCAGTCCCCGTCTACATGACGTAGGGTTGGTCCACGAAGGCCCATTCGAAGATCTGCTCGTACT
GCTCGGCGGCATGGTCCCACGTATGGTCTTTCGTCATGCCTCGCTTCATGAGCCCCTCCCAGGACGGCTTGTGCTCCCTGAATGTCGACATCGCGGTTCG
CAATGCCCACAACATCTTGTCCACGGTTAGCGGTGAGAACGCCCACCCTGTACCCTCCTCTCCTTTTGCACCAAAAGGGTTGAAGGTCTCGACTGTGTCT
CGGAGGCCCCCAGTTCCATGAACTACAGGAACTGTACCATATTGCATAGCATATAGCTGATTAAGACCACAAGGTTCAAACCTGGATGGCATTAACAATA
TATCGCAACCTGCAGTTATTCTGTG
page-top