Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16901  (registered. 2003)
Contig Information
Length 1419 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os03g0163400 [Oryza sativa (japonica cultivar-group)] >gi|20219051|gb|AAM15795.1|AC104428_16 Hypothetical protein [Oryza sativa (japonica cultivar-group)] >gi|22773248|gb|AAN06854.1| Hypothetical protein [Oryza sativa (japonica cultivar-group)] >gi|113547529|dbj|BAF10972.1| Os03g0163400 [Oryza sativa (japonica cultivar-group)] >gi|125585023|gb|EAZ25687.1| hypothetical protein OsJ_009170 [Oryza sativa (japonica cultivar-group)]
Score 284
Evalue 2.46578e-36
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16901
ATCAACTGCTAAGCCTACCCTGATTTCAGTCGCCGCCGCACCATCTTCGACTTGTAGGTATCAAGGGCAACTGCAACACTTTTCTAAGGAATTAGAGCAA
GGTGGAAGGAGATGGGTTTTTTGTTTTCTAAGTATCTTGCGAGGCGAGGAACTAGGATTTCAAAGCGGCGGTCCGGTCAGCGCGTCGGCGGCCGTGAGCG
AAAGCGTCGGCGGCATCACCTTTACCTTGTCTTTGATGACTGGTCGCTCGGGTATAGCATCCGCAAGGTAGACTCATCGCCTGGCTCTCGTCGCCAATCC
GCTGTGAGGCGCTTGCCTCGGCCTTTCTTCCGATTACAGGCGCCGCATGGGTCGCCGGAGTACTTCGCGTCAGCCTTTGGCACCAACATCTTGTCGATGC
ATCCCAGGTCTACCTCTTGCAACAGCTTGTTATCCGGGAGCTGTATCCTCACCTTGGACGTCCGCTCGCGGGCTATCACGTTTGGCCCTCGGTTGGAAAA
TACGATTACCCTTTGCCCTCGGTGGAAAAATCCGATTAATCCCATCTATCTCGCCGTCGACAATAAGCTATTCACTCTAAGCAAACACTCCTTCGAGATA
CTCTCCTTGGATCTGCTCAGCCCCGTGCCGCCGGATCGATCTGGCAGAGTGAGGTGGTCGTGGGAAGTTCTCACGAAGCAGCCGTTCAAGGTTCGCAACG
TCACCTCCTACGCATTGAACCCCTACAGCCAGTCCTTCCTGGTGAGCACCACGAAGAAAGCTATTGCGGACACGTTTGCCTTTGACACGGTAAAGCTTTC
ATGGAAACAAGTAGGCAAATGGGCGCTGCCCCTTCCACGGCCGCGGCCACTTTGACCCTCTCCTGGGCGCCTTTGTCGGGCTCTCCAAAGATCCAGACAC
CTTCGGACAACTCTACTTCTGCTACATGCCCAGCTCCGACACTGGCCACACCCCTAAGTCGAAGCTCGGCAAGATGAAACTGCTCAGTGAGGACCCAGCC
GAGAGGCATGTAAGCGCCACCCTCGTCTACATGGGGCGCCGGAGCAAATTCTGCCTGATAGAGTGCGTCTCCATTGAGGGCGACAGTGCTGATCAGGAGC
TCAAGGAAGAGGGAGTCATGCCCCGACCTGGCCGCTGTCTTTATCGTTTGACCACATTCTCTCTCAGCCATGACATGAACGGAGACCCGACCACTGGCGG
CAGCTGTCGAGTGCAATACTACAAAGTGCCCGAAGCAACCACTCCGACGTTCTTGTTTGCAGATCCTGTTGTATTTTGGATGTAAAATGTTAAAATAATG
TCATAATGACGACTTCCTATGTTTAATTTTCACTCATTTGTTATTGCGTTGTGCCTAGTATAAATTTGACATTTATTTTGGGACGGAGGACGTATGTTCT
AATAATGTGCACGCCATAT
page-top