Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16879  (registered. 2003)
Contig Information
Length 912 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Homology (BLAST) Top Hit Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|49388178|dbj|BAD25304.1| putative replication protein A2 [Oryza sativa Japonica Group] >gi|113537041|dbj|BAF09424.1| Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|215707148|dbj|BAG93608.1| unnamed protein product [Oryza sativa Japonica Group]
Score 504
Evalue 2.7597e-56
Total Hit Count 149
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16879
ACACGACGACAGTCCAGTTTCGTTGTCAATGGCACCGAGGTGTCCACGGTTAGGCTTGTAGGACGCATGATGAATAAGGCAGAGCGGATCACAGAATGTA
CGATTCATTCTTGATGATGGTACAGGCAGGATAGAAGTGAATCGCTGGGCAAATGAGACATCGGACAATACAGAAATGGGTTTAGTCAAGGATGGTGACT
ATGTTATTGTCAATGGTGGTCTGAAAGGTTTTCAAGGGAAGCGTCACATTGTTGCTTATTCCGTGCGGCTTGTAACCAACTACAATGATATAACACATCA
CTTTCTGTACTGCATTTATGTGCATTTGGATCTTGCCAAGGCTAAGAAATCTGCGACGCAGCCCCAAGTAACTGCTAATGCATCAACATGGAACCAAGCT
CCACCCCCTAATAATCAGGCCCCAACACTATCTGCATCTGGGAATGCTGGTGGGCAAGAGTTAACTGATATGGTCATGAATGTTTTTCATGACCCAGTGC
TTGTAAACCTGGAGCATGGAGTTAGTATCGCACAGGTTGCAAGCCGTCTTAACATATCAGATGCACTTGCCAGGTCGACTGTTGCACATCTTATTGATCT
TGGCAACCTCTATCCAACTATTGATGACAACCATTACAAGTCTACACTGAATGGTTGATATGGCTGTGTCCACGCATGCAAGAGTTAGGCTCCCCTGGAG
CTATCGAAATAATATAAGCACTCTTGGAAGAGTTGTTTTTGCAGAGTGGCTTGCTGGTCCTCTAGACAGTCGCAAGGAGAGCAACTTAACGGCTAGGTTA
AGTTGCATATCTAAGTACTTGCGCCTTATATGTAATGGTCTAATGGACATGAGTAGGTTAGATCTCTAGGTGCTTTGTTTGTGTTTGCTACTGCAGTACC
TCCAGAACATCC
page-top