Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16849  (registered. 2003)
Contig Information
Length 1056 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit hypothetical protein OsJ_000158 [Oryza sativa (japonica cultivar-group)]
Score 119
Evalue 1.50102e-09
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16849
TTTTTTTTTTAAACGAGCCATTACAGACATATATAATGAAGGTAGCAACAGACCACAGCCTACGACCATTACAAGTTCACCCATGCTTCCAACTGTGCCA
TATTTAAACCATCACACCCCGACTCTAATAGATATAAAAAGCACAGAAGGCTATCAGCGAATTAACTACTTATAAAATAGATAAATGCAGGGACACGTTA
AAGACAAGATATAGATGCCTGGAGCTGAAGGTAATTAACCACAACAATCGAAGCAAGAGCTACACTGTTGAAAGCGCCACGAGTTGAGCTGCTCTTCTTT
TTTTCCATCTATATCAGACGATTCTTCTTTTCCTTGTGCAGAAGACCATCAGACAATCCAGTGTGGCTCGCACAGAACTTGACAGCAAGCAGGGTAGGTA
TGTCAGGATGGAAATCTTTGGAAGGCTCGACTCTCCACGGCGGTGGCGCTGGTAAGCCATCTTTGATCGGACGATGGCTGCAGGACAGGAGAGACTTTGT
GCGCATGTTGATGCTGATCACACACTCAATCTCCCTGCATAGCCGAGCCCCTCCCTCCCAATCGATGTAGTAATCTCCCAGCAAGAGGTAGAGGACACCA
TCCTCGTCGGCCTTGAGGACTGGGCACTGCGGCATGGCCTGCGGCAGCCTCTCACGCTTGTAGGCCTCCGACTGCCAGAGCAGCGGCAAGGGCAGCTCCA
TGTCTTCATCTCTCGTCCATGAGTGAAGGTCTGGCGACAGAGTCCAGCTCCGCAGCACAACGTCAGCAGGGGGCGTGTTGTCACGGGGGTTGTCGCCACT
GATGGTGACAATGGAGATGAGCTTTATGGAGTCCCCGACAGGGCCCATGGTCCGACGATCCTTGGGGTAACTGCGGGGAGAAGTCACGGCCTTGGCACTC
CTCGGGAAGATGAATGAAGTCCAGCTCCACGTGGTCAAGGTCTTCCCTGGTAGTGGTACCGGTGGATGGCATGTCACAGACAATGGCGCCAAGCATGAGA
TCGGCCCAGAAAACCTTCCCTTTGAAAGTGAAGGCCGCGTCTACTTGTCCGCCGGC
page-top