Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7027  (registered. 2012)
Contig Information
Length 1266 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 4
Wh_SH - 5
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|251832993|gb|ACT22500.1|| plastid glutamine synthetase 2 [Triticum aestivum]
Score 688
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7027
GGAGGACCCGTCAGAGCTACCCAAATGGAATTATGACGGATCGAGCACCGGGCAGGCTCCTGGAGAAGACAGTGAAGTCATTCTATACCCACAGGCCATA
TTCAAGGACCCATTCCGAGGAGGCAACAACATCCTGGTTATCTGTGACACCTACACGCCACAAGGGGAACCCATCCCTACTAACAAGCGACACATGGCTG
CACAAATCTTCAGTGACCCCAAGGTCACTGCACAAGTGCCATGGTTTGGAATCGAACAGGAGTACACTCTGATGCAGAGGGATGTGAACTGGCCTCTTGG
CTGGCCTGTTGGAGGGTACCCTGGCCCCCAGGGTCCATACTACTGCGCCGTAGGATCAGACAAGTCATTTGGCCGTGACATATCCGATGCTCACTACAAG
GCCTGCCTTTACGCGGGAATTGAAATCAGTGGAACAAACGGGGAGGTCATGCCTGGTCAGTGGGAGTACCAGGTTGGACCTAGCGTTGGTATTGATGCGG
GAGACCACATATGGGCTTCAAGATACATTCTCGAGAGAATCACGGAGCAAGCTGGTGTGGTGCTCACCCTTGACCCAAAACCAATCCAGGGTGACTGGAA
TGGAGCTGGCTGCCACACAAATTACAGTACACTGAGCATGCGCGAAGATGGAGGTTTCGACGTGATCAAGAAGGCAATCCTGAACCTTTCACTTCGCCAT
GACTTGCACATAGCCGCATATGGTGAAGGGAACGAGCGGAGGTTGACAGGGCTACACGAGACAGCTAGCATTTCAGACTTCTCATGGGGTGTTGCGAACC
GTGGCTGCTCTATTCGTGTGGGCCGAGAGACCGAGGCAAAGGGCAAAGGATACCTGGAGGACCGTCGCCCGGCGTCGAACATGGACCCGTACACCGTGAC
GGCGCTGCTGGCCGAGACCACGATCCTGTGGGAGCCGACCCTCGAGGCGGAGGCCCTCGCTGCCAAGAAGCTGGCGCTGAAGGTATGAAGGACCTGAAAA
GGCCGAATTCTTCTGGGGAAAAGAAAATAAATCGGCGGTGGCGAGGCTGTTCGTCCGTCGTCCATTCTTGTTGATCCTGTGGTTCCGTCGGGGCACTGTC
TGTACAAAATCTTCACGGTTTGTAGAACCGCTCCGCATGTTTTTTCGCTTGAACTGAGTCCATTTGATCTGTTGGGTCTGTACAATCCCTGTACCTGAGT
CCATTCGGAGAACTACGTTATTATAAGGATAATGAATCACACAAAGGATTTTTCTTAAAAAAAAAA
page-top