Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16825  (registered. 2003)
Contig Information
Length 651 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit chaperonin [Zea mays]
Score 630
Evalue 5.8174e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16825
CTTAGGCAGCAACATCGTTGAGATCAGTGTTCCGGTTGGTGCCAAAGTTATTTACTCTAAATACGCTGGCACCGAGCTGGAATTCAATGATACCACCCAC
CTCATTATGAAAGAAGATGACATCATTGGTATTCTTGACACTGATGACGTGAAAGATCTGAAGCCACTGAGTGACCGTATTCTCATTAAGGTTGCAGAGT
CTGAAGAGGAAACTGCTGGCGGTTTGCTATTGACACAGGCGTCGAAAGAGAAGCCTTCCGTTGGAACAGTGGTCGCTGTTGGCCCCGGGCCATTGGGCGA
TGATGGCAGCAGGACACCATTGTCAATCACTCCTGGAAGCAGCGTGCTGTACTCCAAGTATGCAGGAAGCGAGTTCAAGGGTTCGGAAGGCGAGTACATT
GTTCTCAGGTCATCCGACGTGATAGCGGTGCTGTCATCATAAGCTTGCCCTGCCCTACGTGAACTAGGAATTTTGATATTTAGTCCAAAACCTTGTTTGG
TTATTGCTCTTTGCTTGTGATTGGTGAACTGTGAATTGCTTCTTCGCTCTATCGTGGAAATGCTGCTTGATAGTTTTAATAAGATGACGGCTTAGACTTC
AAAAAAAAAAAAAAAAANCCCNNGTTTTTTTTTTTTTTTTTNAAAAAAAAA
page-top