Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16812  (registered. 2003)
Contig Information
Length 877 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 3
Homology (BLAST) Top Hit hypothetical protein OsJ_003116 [Oryza sativa (japonica cultivar-group)]
Score 1091
Evalue 3.58837e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16812
AAGACGTACTCCTATCTATAGGAAATAATGAGACCAATAATGAGACCGCTTGAGGCTAGCTATCAATTCTTCGGTCGAACTATGAGTTACAACAACAATA
TCCCAGAGCAGCAGCTTCAGTTATTCTGTGCGAACAGCGAAAATACTCTTGAAGTAAATTTGTCGTCAGAAACAGTCTGTGAGCGGAACCAACTGAGCTC
TGGCAAATTAGAGATCGGCCCAACTGCAGCAAGGGCAACATCCTTGTCAATTATAAACTCCTTGGCTGTTTTCATTACTGTATCGCAGTCAACAGCATCA
ATCCGAGCAAAAAGCTCCAAGAATGGCATTACTCGTCCATAAGTAAGCATCTGGCGACCATTATTTTCAGAAACTGCAGTTGATCCATCAAAGTGAAGCA
AAAGAGAGGACTTCAACTGATTACGAGCACGAGCAACCTCTGTCTCTGACACTCTGAATGCAAGTCTTCTAAATTCTTCCATTATTAACCGTGACAGGTC
ATGTAGTGCGTCAGGCGGAGCACTAGTATAGATGCCAAATAATCCTGTATCGCGATAGTTAGTGTTGAATGCCATCAAGTTCTCAGCTAGCTCACCATTG
CTGATGCCACGAGCTAAAGCAGACCCTGAGCAGTTCCCTACGCCGATGCTCCTATTCCAAGATCCCAATATGCTTTGGGTCACCATAAGAGGAATAGAGC
TAGGGTCAGTCCAGGATGAACCCTTGAAAGCAATTGCAATATGCGCTAGAGGCATCTCGGCATTCTCCACACGAACCTCTGAGCCAGTAAAAATAGCCGG
ATTTGCCTCAACAAGCTGATCTGCAGTAGTTGGATCAGTAGAGAATCCTGTAAACAATTTTCTGACTTGATCAACAA
page-top