Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16810  (registered. 2003)
Contig Information
Length 736 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 408
Evalue 4.17284e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16810
GCATCTCGAGTAGTTTCCAGTTCGCCGGAGAAGGAGAAAGATGGCCGGAAGGAAGGGCGGCGACAGGAAGAAGGCGGTGACCCGCTCCGTCAAGGCCGGG
CTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTGAAGAAGGGCCGCTACGCACAGCGCGTCGGCTCCGGCGCCCCCGTCTACCTCGCCGCCGTCCTCG
AGTACCTCGCCGCCGAGGTCCTGGAGCTTGCAGGCAACGCTGCCAAGGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCTTCTTGCCGTCCGCAA
CGACCAGGAGCTCGGCAGGCTGCTCGCCGGCGTGACCATCGCCCACGGCGGCGTGATCCCCAACATCAACCCCGTGCTGCTCCCCAAGAAGGCCCTCGAG
AAGGCCGAGAAGGAGTCCCAGTCGCCCAAGTCGCCCAAGAGGAAGGCCCCCGCCCCCGCACCCGCCGCCAAGAAGACCCCCAAGAAGACCGCCGCCGACA
AGAAGACCGCCGCCGCCGACAAGAAGACCGCCGCCGCCGACAAGAAGACCGCCGCCGCTGACAAGAAGACCGCCGCCGCCGACAAGAAGGCTGCCGCCGA
CGCCGAGGAGGAGGCCGCCGCCGACGAGTAGACAGGGCAAAGTTGCGTCGCGTAGTTCTGCATCTGAGAGGGGAGAGAAAGAGAGAGAGCATGGGATCCT
GTATGTAATGCCTGGTCTGGAGTCCGAACTGGTGGT
page-top