Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16753  (registered. 2003)
Contig Information
Length 1473 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_008136 [Oryza sativa (japonica cultivar-group)]
Score 601
Evalue 4.83833e-120
Total Hit Count 310
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16753
ATGATGCAGTACATTTGCCGCTGTAATTCGAACAGCCATCAGGTAAGCCTGTTTCCGCCGGCATAACAAGAAAATTACAGAATTTATAAATCTTAGGAAA
CTCGCTCGACAAGACAAGTTCTCACTTCCGAAATACTTCTACCATGGTCCTGCACACTAAAGTTCTAGCGCCGCCTACTAAAAACTGTACAGATGTAACA
CACATTGGTTCGGTAAACTCAAAATCGGCATACCCCTGGCTTCTCAGTACGGCAGAGCTTGAGCATCTCTTCGTACCTTGAAGGATAGACGAAGCCCCAT
AGCTCAACGTCTTTAACTGCAAAGTCTGGAGAATGTGACAGACACTGGTTGTTAAAAGTCTCCGAATTTGAACTTGAACCACTCAAAAGGTCTGAGTCTA
GATAAAGTGCGAAATGACCTCCACCTCCTAGTGCCAAATAGTCAGCAGAGCACACAGTATAATACTTATTGGCACCTGTTGGCCGGTATATAGCAGGATC
GCTGTGTAAATTAGTGAAAACAAAGCAGTTATTGGTACCCTGATACTTCTTTGTGCTAGTTGGCTGTAATGGAGCCTCAACTAGACCACCAAAAATCGCC
CCCTTTCTGTCCCCAACTACCAGGAGTGAGTAACCAGGGGCACAGCAAACTCCTTCTATATAAAGTAGACAAAGATATTCCATGCCTCCATGTGCTGTAT
AGCAAAACCCAGCTCCTTCCTTGGGCCAGAATAGGAAGAGAGGAATAAAGAGTGGATCGCATTGTTTCTGACAAAAGGACAGATGGCTCTGACATAGCTG
GCATGTTGGTCAGGGAGTTAACTTCATTTGGTCCTTCGAGCTCCAATGCAGGTGCAGCTGATTCAGCATGACTCGCCACCTCTTTGTCAGTTTTAGGTTC
CGAGTTTTGTTTGAAACCGCTCATCCTAGCCGCTTTATTAATGATTTTTCCAATGGAATGCTTCCCTCTGCTTAGCAAGCCTGTCTTTCCCTTGGTTGCC
TTCCCAACTGGTGTTAAAGTTGGGTATCCCATTTCTTCACTCTGCTCGGGGATTATCTCCCTTGAATCGTTAAAAGAGCTAGACGGCGACAAAAATGAGA
TCATGAATGCTCTAAACGAAGATGTATCGGGGCCATCAGGGTTATCAGAATTATGGTCAGAATCTTTGTCGTCTTCTGATTTTTCTTGCTCTTCGTCCGC
CTCGGGGAGGTGGGAGGGCTCGCGCTCGGAGACGGGGTTGAGGATGACGGTGGTGAGGTCGGACACGAAGTGCGCCGCCTTGCTGCCGAGGGAGGACGGC
AGGTACCCCATCCCCGCGCGCCCCGCGCCTATTCCTGGAGCGGCCGCTAAGTTTAGGCGGGGGGCGGCGCACCGCAGCTGCCTGGGTTGGGGATTCGCGC
TCTTCTCGGAGGACTCGTGCTCTACCCGGGGGGGCGGTGAATGGGGAGACGCCGGCGAGAGAGAGAGAGTGGT
page-top