Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16667  (registered. 2003)
Contig Information
Length 1936 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_32230 [Oryza sativa Indica Group]
Score 709
Evalue 2.18348e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16667
TCTGGGTATCCAAGAGAGAAGAGATCAACCCTAACAATTGTTGACACAACACTAGCAATTATAGGTAGCATTCAGTCAAATCTGAGATGAAGCATTGCCA
AATCTTCAAGCTTCAGTACTCTCAAGTATGCATCTTGCAAGACGGGCTAGGGCCAGCAGAAATGTTCAGGCTTTAGGCAAGATGATAAGCTATAGATTCT
GACTAGAACCATCATATAGAGGTAGCAACAATAGAACAAGCTTACACTGCTGAAAATGCATCCTATATCCAGAAGCAGCATCTAGCATTGTATAGATTGC
AACTCTGCAAATGCACCCTATGTGGTGAGAATAGGGGGCAGGTGTTTGGATTTGATTCCGAGCACCGGAGCAGCCGTGTCGGGGAAGCACCTCGCGCCGG
GCAGCTCTGTCACCGTGCCGTCCTTCGTCACGGCAACCGGGTAGGTGAGAAGGTGCCCGGGGAGGTCGTCGTTCAGCTCATCACTGGCATAGAGGTCCCA
GTACTTGTCAGCCATCTTGTTCACCCTCTGGACGCACTCCCGGCTTCCCGGGTTGAGGAAGTCATTGTGCAGCATGCCGAGGTGCTCATACCACAGCGAC
ATCCGGAAGCCATGGACCTGCCCTCTGGCAACCTGGCCTTTGGTGTTCAGGTGGTGCGGCTGGAATGCGCCCATGGCGATCTCGGAGTCCCTCCCCCCGT
CCATTGATCGCTGGTTGATGTTGGCAGATCCGACGATGATGTACCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGCAGGACAAGCCGCCANCCAACA
CAAACCACCGGACCGGAGCAGCAGCCGACGCCTCACAACCGCCGCCGCGCAGGCAGTCGAGCCGACCGGAGGAAGCCATGGATCGGTACCAGAGGGTGGA
GAAGCCGCGGGAGGAGGTGCCCATCAAGGAGAACGAGATCCGCATCACCACCCAGGGCAGGATGCGCAACTACATCACCTACGCCACCACCCTCTTCCAG
GATAAGGGTTGCGATGAAGTTGTATTCAAGGCAATGGGAAGGGCCATAAACAAAACTGTGATGATTGCAGAATTGATCAAGAGGAGAATTGTGGGTCTCC
ATCAAAACACTGCCACTGAATCCACTGATATTACTGACACATGGGAGCCACTGGAGGAAGGCCTACTTCCGCTTGAGACAACAAGGCATGTGTCTATGAT
TACTCTAACTCTTTCAAAGAAGGAGCTGGACACGTCATCTGTCGGATATCAATCTCCTCTGCCTGCTGACAAGGTGAAGCCGTTTCTTGAATACGAGAAT
GAAGAAGATGCGCACTCGCCTCCTGGGCGAGGAAGAGGCCGTGGCCGAGGCCGTGGAAGGGGAATGGGAAGGGGTAGAGGTGCACGTGGGAATGGATACA
TGGAGTATGCTGACGGTGGATGGGAAAATGAGCATGCTCCTGCCTATGCAGGCAATGGGTATGCTGACCATGGTCCAGCTTATGAGGGTAATGGGTATGC
GCGTGGTAGAGGCCGCGGTTTCAGGGGCCGTGGCAGGAGAGGTGGCTATGGTGGTCAGCCTGGTGGCTATGGTGGTCAGCCTGATTATCAGCATGATGGA
GGGTATTATGATGAGGCACCAGCGCCACCCCGAGGTGGGGGGCGTGGTTTCAGGGGGCGTGGCAGGAGAGGTGGCTATGGTGGTGGCCAGCCTGATTATC
AGCAAGACGGAGGTTATTACGAGGAGGCCCCTTTTCCTGCACCAGCTGGAGGTCGTGGTCGAGGCCGTGGCCGTGGGAGAGGCGGCCCAGCTCGTGGCAG
AGGGCGCGGTGGCAATGCCAATGGCAACATGGTGTATGCCGCCGCTTCGGGCGCATAAGCAGTCCTCATCTCGCTGCTGTTGTTAGTTGGATGCCTGCTC
CAAGCATGAATATGTATCATCTGTGTTGTTTATCTG
page-top