Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7006  (registered. 2012)
Contig Information
Length 728 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|270233745|emb|CBI22354.1|| unnamed protein product [Vitis vinifera]
Score 444
Evalue 4.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7006
CGAGAAATCGACGCGAAGGCTCTCTGCCCGTCCTCAAGATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTCGAGGTCGAGTCGTCGGA
CACCATCGACAATGTCAAGGCCAAAATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTTGAGGATGGCCGC
ACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCAGGCTCCGTGGTGGCATGCAGATTTTTGTGAAGACCCTCACCGGCAAGA
CCATCACCCTTGAGGTCGAGTCCTCGGACACTATCGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCGTCTCATCTT
CGCTGGCAAGCAGCTCGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCAGGCTCCGTGGTGGCATGCAG
ATTTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTGGAGGTTGAGTCCTCGGACACCATCGACAACGTCAAGGCGAAGATCCAGGACAAGGAGGGCA
TCCCCCCGGACCAGCAGCGTCTCATCTTTGCTGGTAAGCAGCTTGAGGATGGCCGCACCCTGGCGGACTATAACATCCAGANNNNGTCCACCCTTCACCT
GGTGCTCAGGCTCAGGGGTGGGATGCAG
page-top