Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7003  (registered. 2012)
Contig Information
Length 1020 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62275661|gb|AAX78232.1|| embryonic flower 2 [Triticum aestivum]
Score 680
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7003
TATCTCGAAGTACAAATACTGAGTTGCCAGAACAGAATATCTTTCCTCTTTATGTTCTGTTGGCTACACCTACTAGTAATATTTCGCTTGAAGGGCATTC
TCCGATATATCGATTCACTCGGGCTTGTTTGCTTACAGCTTTTAGTGAATTTGGTAATAAAGGTCGCACCAAAGCTACATTTATAATTCCAGACATCAAG
AATTTATCAACCTCCCGAGCTTGCAACCTTAACATTATCCTTATCAGCTGTGTTTCGGAAGGGCAAGTTGGGGAAAATCTTGGTGAAAGTAACTTCTCTG
TGGACCATGTGGAAGGCTCTGCTCTCCAAAAGCTTGAAGGGAAATGTTTCTGGGGTAAAATACCAATTGATCTACTTGGTTCGTCTTTGGAGAACTGTGT
AACTTTAAATTTGGGACATACAGTGGAGTTGGCTTCTGCAGTTAGTATGAGCCCAAGTTTCTTAGAGCCGAAATTTATGGAGCAGGACAGTTGCTTGACA
TTTTGCTCTCATAAGGTTGATGCTACGGGTTCATATCAACTCCAAGTAGGCATATCTGCTCAAGAAGCTGGTGCAAAAGACATGTCTGAATCTCCATATA
GTAGTTACTCATACAGTGGTGTCCCACCTTCATCATTACCACATATCATAAGGTTGAGAGCTGGTAATGTGCTTTTCAACTTCAAGTACTACAACAATAC
TATGCAAAAGACTGAAGTCACTGAAGATTTTGCTTGCCCCTTCTGCTTGGTAAAATGTGGAAGCTACAAGGGTTTGGGGTGTCACTTGAACTCATCACAT
GACCTATTCCACTTTGAGTTTTGGATATCTGAAGAATGCCAGGCTGTTAATGTTAGTCTGAAGACTGATGTCTGGAGAACTGAGCTTGTGGCTGAGGGAG
TTGATCCAAGACATCAAACATTTTCCTACTCCTCAAGGTTTAAGAAGCGTAGANNNTTGGGAATGTTGGGAACCACAGCTGAGAAAATAAGCCATGTACA
TCCACATATCATGGATTCAG
page-top