Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16587  (registered. 2003)
Contig Information
Length 732 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 786
Evalue 6.04143e-82
Total Hit Count 467
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16587
AAAGAGAAAAGTCACCAGGTAGTTTCAGTTACGACAGTCGGACGGACGGACGGTGGGGGTTGGGTTGGGTTGGCACAACGAAAGGGAAAAAAACTTTACA
ATCTGTTTTGCTACTCTCTTGTCCAAGAGCAAGCCAGAGAGAGAACTCCATGTTGGCTCCACAATCTCTTTCTTGCATGCTAGCTCTTCTGGCACCGCTT
GCCCCGGAACTAACGAAAACAGGCCTTTCGCTAGCTCAGCAGCAACTTGAATATGTCGCTCAGCGATATTACGCCTTCCACTCGCTTGCTGCCAGCCTCC
ACGATGAACACGCGACGCACCCCAGGATTAGCCAATCTCTCCATAACCTTCAGCAAAGGGTCAGACTGGAGACACATCTGGCATCTTTGACCATTGAAAA
GTCCAAAAGGTGAATTCGCGTCTTGCCCGAGCTGCAAGGCCTGATGAATGGTCATCTCATCTAGGCGGATATGGGTGTAGACCTTGTCTTTCGCTAGAGC
TGTGATGTCACTTCTGGAGTATGTGTCGATCAGCGAGTCGTTATCATCCACAATGGGTATTGAACTAACTCCAGCTTGAACCAACAAGTTAAGGGCAGAG
CTAAGAGATGTATTAGGCCGCAACATAGCCAATGGATGACCATTTGGTTCACCAATTTTTGGAACCCAGGTACCCAGCGGAATTGAGCATACTGGTTGGT
TTAGAATCGGCAAACTACCAGTGGAGTTCTGA
page-top