Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16572  (registered. 2003)
Contig Information
Length 1444 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Os04g0466600 [Oryza sativa (japonica cultivar-group)] >gi|113564603|dbj|BAF14946.1| Os04g0466600 [Oryza sativa (japonica cultivar-group)] >gi|116309723|emb|CAH66768.1| OSIGBa0115M15.6 [Oryza sativa (indica cultivar-group)] >gi|215769308|dbj|BAH01537.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1691
Evalue 0
Total Hit Count 466
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16572
AGTCCTTTCCATGGGGCAAGCACAAAAAATTCCAGGAATGCGAATGCGAATGCAAATGCGAAAGATACAGTCTGAACACACCTACAATATTATTCAGTAA
TCTCCAAATGAGATGCATCTATTGGCCCGCGACACGGTTTCAAAGTGCAACCGATATGCTGCGGGCGTAACCAATATGGTTGAATCATCACCCCAATGCA
GGGCTTGGTCGCCTTTCCTCGCCGCTCATCTATGACGGGCGCACCGGCTGCTGCTGCGTGATGCAGTGTATGTTCCCACCTCCCAGCACGATCTCCCTTG
CGCCTTCCACCATCACAACCTCACGATCAGGAAATGCCTTCTGAAGAACCTCGCACGCTTCGTCATCCCGCTTCTTATCGCCAAAAGCCGGCGCTATGAT
CCCGCCATTCGCTGGGTAGAAGTTCACATATGAGGCGGCCAATCTCTTGCCTGGTACCCTCGGTACAGCATGCCCCGTTGCAAGAACACCTTCCCCCTCT
TCCTTCGTGATGTACAGAGGCCCTGGCACGTGGATCTTCACCACCTCTATCTGCCGCCCTTTCGCATCGACGGCCTGAGTGAGAGCTGATAGTGCCTTCA
CAGATATCTCGTACTGCGGGTCGTTCTCGTCATCCGTCCATGACAAGAGAATCACGCCGGGTTTGATGAAACAGCATAAATTGTCAACATGCCCATTTGT
ATCCTCGTCACCGTGTAGTCCCAGAGGTATCCAAATGATCTTCGTGACTCCAAGAAAATCCTTCAGTTCATTCTCTATCTCTAGTTTAGTCATGTGAGGG
TTCCTGTTAGGATTCAACAAGCATTCTTCTGTTGTAATGCATGTACCTTCTCCATCTACATGAATGCTTCCACCCTCAAGAACCATTGTGTGTGCAAACC
TAGGGATCCTCTCAATCTCAACTATCTTCTTGGCAATGCTTCTGTCAAGACTCCAATCATCAAAGCAACCACCACCGAGTCCTCCCCATGCGTTAAATTC
CCAGTCAATCCCCGCTATTGTTTGCTCTGCGAGTCCTATATCAGATCCGCCTTCACGGGTAATAAAAGTGGGACCAGTATCACGGAACCAGGAATCATTC
ATGCTCATCTCGACCACCCTGATGTTCGGTTGGTGTTCCATCAGCTCGTGGACACGAGGATACTGTTTGGCACTTGCGCAAATGGTGACAGGCTCAAACT
TTGAAATGGCAATTGCAGTTCTCTCAAATGTTTTTCGAGCTGGCTCAGCATGCTCCCGCCAGTTGTCTGGACGCTCCGGCCAGCCCATCCAGCACTGCTC
GTGCGGCTCCCACTCGGCGGGCATCCGGAACCTCATCTTCGCCGGGCATCCCGCCATGGCCTTCACCATCCTCCTCCCCTCCCCTCGGCTCGGCTCTCGC
CAAACCTAGATTGATTCGATCTTCCGCTGCGCTGATCTGAGGAT
page-top