Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7000  (registered. 2012)
Contig Information
Length 1543 bp
Clones alternative view 83 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 9
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 6
Wh_VWD Shoot grown with dessication 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
WH_SP 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655495|emb|CAJ01713.1|| methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 939
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7000
AGGGCCTCTCCTCCTCCTCCTCCCCGTTGCTCGCCGCCGTCCCTCTCCGCCTCCGCGCACCCAGGAAAGATGGCGTCCCACATTGTCGGATACCCGCGCA
TGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCGAGGATTTGGAGAAGGTTGCCACCGACCTCAGGGCCAG
CATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTATGATCAGGTTCTTGACACCACCGCCATGCTCGGTGCC
GTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCA
AGTGGTTTGACACCAACTACCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGC
TAAGGCGCTTGGCGTTGATACCGTCCCCGTACTTGTCGGACCAGTCTCATACTTGTTACTCTCAAAGGCCGCCAAGGGCGTAGAGAAATCATTCTCTCCC
CTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGTTGAAGGCAGCTGGCGCTTCATGGATTCAGTTTGATGAGCCCACCCTTG
TTAAGGACCTTGAATCCCACCAATTGTCTGCATTCTCTGCAGCTTACGCAGAACTTGAGTCCGCACTTTCTGGATTGAACGTTCTTGTTGAGACCTACTT
CGCTGACGTTCCCGCAGACTCGTACAAGACTCTTACATCATTGAGCAGTGTAACTGCTTATGGTTTTGACCTTGAACGTGGAACCAAGACTCTTGAGCTT
GTCAAGAGTGGTTTCCCTGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATTTGGGCTGATGACCTTGCTGCATCTCTCGCCACTCTTC
AGTCTCTCGAGGCTGTTGTTGGGAAGGACAAGCTTGTCGTATCGACTTCGTGCTCACTCATGCACACTGCTGTGGACCTTGTAAATGAGACCAAGCTTGA
TGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGCCAAGGCATTGGCTGGTCAAAAGGATGAGGCTTACTTC
GCAGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTCCAGAAGGCTGCTACTGCTCTCAAGGGCTCTGATCACC
GCCGTGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAGAAGAAGCTCAACCTTCCGGTCCTTCCCACGACCACCATTGGATCATTCCCACAGACCGT
GGAGCTCAGGAGAGTTCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAACGCCATCAAGGAGGAAATTAGCAAGGTTGTTAAGATC
CAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCAG
page-top