Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig70  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 4
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_CA 2
WH_SP 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050876|ref|XP_002463182.1|| hypothetical protein SORBIDRAFT_02g039270 [Sorghum bicolor]
Score 461
Evalue 5.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig70
GCCCGAGCTAGGGTTTTATCCCACACACGGGCCAGCCCGTATAAGTAGTCCCGTCCCCAACCCGTCGCGACCTCTCCCGCCGCCACCACCCGTGCCTCCT
CTTCCCCTTCGCTCTCTCGCGCACGGGGCTCGCGTCCGAAACCCTAACCTCCCACCATGGCGGCTGAAGGCGGTGGCGTCCGGGCGCTGTCCCAGCGCGA
GCAGGACATCCAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCAGATGGAGCGCTACGTCTACAAGCGCCGCACTGACGGC
ATTTACATCATCAACCTTGGCAAGACCTGGGAGAAGCTTCAGATGGCCGCACGGGTCATTGTTGCGATTGAAAACCCTCAGGACATCATTGTGCAATCTG
CTAGGCCCTATGGACAGAGGGCTGTCCTCAAGTTTGCCCAGTACACTGGTGCTAACGCCATTGCTGGCAGGCACACTCCTGGTACATTCACCAACCAGAT
GCAGACTTCATTCAGTGAGCCACGCCTTCTTATCCTGACCGACCCCAGGACTGATCACCAGCCTATCAAGGAGTCTGCACTTGGAAACATCCCCACCATT
GCCTTCTGCGACACTGACTCTCCTATGCGTTACGTTGATATTGGCATTCCTGCTAACAACAAGGGGAAGCAGAGCATTGGTTGCCTATTTTGGCTGCTCG
CCAGGATGGTTCTGCAGATGCGTGGTACCATTCTCCCAGGACACAAGTGGGAAATCATGGTTGATCTGTTCTTCTACAGGGACCCAGAGGAAGCTAAGGA
GCTTGANNNNGATGAAGCTTTGGGTGCTCCTGAGTACGCTGCAGTTGCAGAGTACACTGCCCCAGCAGGGGATACCTGGGGT
page-top