Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7  (registered. 2012)
Contig Information
Length 1979 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_CA 9
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XV Leaves, plant was grown at constant 23℃ 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|259166850|gb|ACV97161.1|| cytosolic glucose 6 phosphate dehydrogenase [Hordeum vulgare subsp.
Score 530
Evalue 4.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7
TTTTTTTTTTGACTGAAACACTCCATTTTTTATTTCACACCGTGGTGAGGTATACTCCGTCAAACAGATCCGTTATTACAACGCCAGGTAAACCGCAGTA
CAGCTAAAATTCGTAAGATTTTTATCCGTGATACTTTCACTCTTCCTAGCTAAACAACCCTACAAGGATCGAGGGAGGCACTCTATGCAAGGGTGGGTGG
TATCCAGATGTAACCGTGGGTCTGCATGTACCCAACCTTCTCACTCAGTTCATCAGCTTCCTTGGGGCCTCGGCTGCCAGGCTTGTATGAAACAGCCTTC
AGCTTGCCGGCGTCGATGTCGTGCAACAAGGGAGTGAAGATCTGCCAGGCAGCCTTCAGCTCATCTCGGCGCACAAAGTGTTGCTGGTCTCCTCTTATTG
TATCCAAAATGAGGCGCTCATATGCCTCTGGAATTTTGACATCTTGGTAACGCATCCCATATGACAGATCAAGTTCACTCTGTTCAGTAGCCATTTCCAA
TCCAGGTTTCTTCACAGTTAGTTTCATGTACATGGCTTCTGATGGCTGGAGGCGTATGACAAACTCATTTCTTCCCTGCTTCTTACATTTAAAAATGTCA
CCGGGAACATCCTTGAACTGCACACGAATTTCTGCTTTTCTTGAGTTTAATGCTTTACCAGCTTTAAGAATGAAAGGAACACCTTCCCATCTTTCATTGT
GTACCCTAAGTACAATAGATGCAAACGTTGGGGTATTAGAGTCATCTGGCACTGTAGGGTCATCCTTGTAGCCCTGATATTGTCCAAGGACTACCTCTTC
GTCCTTTATCGGGTTCACGGATTGCAGAACCTTGACTTTCTCATCTCTGATGTGCTCAGGCTTAAGAGATACAGGCTTTTCCATTGCAACCAAACAGAAA
ACCTGCAACAAATGGTTCTGAATGATATCACGGATGATTCCATATTGATCAAAATATCCTCCACGTCCACCTCGTGCCGAATTCGGCACGAGGAAGCCTT
CTTTCTTGTGCTTGATGATATCATGGACGACTCCCACACTCGACGTGGGCAGCCTTGTTGGTTTAGGGTGTCTCGGGTTGGCTTGATTGCTGTAAATGAT
GGGATTCTCCTTCGCAACCATATTTCGAGAATGCTTCGGCTCCACTTTAAGAAGAAGCCTTACTATGCCGATCTCCTTGATTTATTCAACGAGGTTGAGT
TCAAGACAGCTTCTGGTCAAATGCTGGATCTTATTACAACCCACGAGGGAGAAAAAGATCTAACAAAATATAACATTGGAGTCCACCGCCGAATTGTTCA
ATTCAAGACAGCCTACTATTCATTTTATCTGCCGGTTGCATGTGCGCTGCTACTCTCTGGTGAGAGTTTGGAGAACTACGGTGCTGTAGAGAACATACTT
GTCGAGATGGGAACTTACTTCCAAGTTCAGGATGATTATCTAGACTGTTATGGTGATCCTGAATTTATTGGCAAGATTGGCACCGACATTGAAGATTACA
AGTGCTCCTGGCTAGTTGTCCAAGCTCTTGAGCGTGCTGATGAGAGCCAAAAGAGCATTCTATTTGAAAACTATGGAAAGAAAGATCCAGCATGCGTGGC
AAAAGTGAAGGATCTCTACAAAGAACTTGACCTTGAGGCGGTATTTCATGAGTACGAGAGCGAGAGCTACAAGAAGCTGATTGCTGGTATCGAAGCCCAG
CCGAGCGACGCTGTTCAGAAGGTTCTGAAGTCCTTCTTGCACAAGATCTACAAGAGGCAGAAGTAGGGTGTCTCTTGGGCAGGAAATCTGCTCCATTGTC
GCATGTTTGATAGATGACTAGTGGTGTTGATTTTATGGTTTAGTGCTTCATGTTGTATGTTGCGCCTTGCTGCTCCCAGTAGTAATAATGATGCAAGGCG
CTATTTCGGGTTTAATGGACCGCCTTGGTGTAGACGACTGATGGTTCTGTAATTTGCACCTTGCCCTTTAAAAAAAAAA
page-top