Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6999  (registered. 2012)
Contig Information
Length 875 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625649|gb|EEE59781.1|| hypothetical protein OsJ_12287 [Oryza sativa Japonica Group]
Score 283
Evalue 2.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6999
TTTTTTTTTTCATGCGGCATTGCGGAGCACTTTACTGGCAAAATCAAGCTGTTTCAACAAATAATTGTCAAAATCGATATTATACATGACGGGAGCGCAT
TGGTAGATCACATCTGAGGGGACATTGCTGCTATGATCGACTCTCCAAACCTATGCTTTTTTTACTTTGCTTTATCAAAACTTGGGGGAGAACATGCAAA
ATGACTCCACGAATGACAACCCCGTTGCCACCAGCAATGACGATTCAATACCCTTGCGAAGCGCAAAGAGCATATGCCGCATCACAGATCCATGGCGCTC
AGGCACTTCCATTCCATCCCCAAGACACAGTTGTTTGTGCACAAAATCAGCAGCCATATTTTCAGAAAGAAATAATTCCATGGGCTTGGCACTTACGGGA
ATAGCTTCTTTAATCTATTAATAGCTACACCAGCCGTCTTGTTCATTGGCTCTAGAACAAGGGCATGGCTAAAATCATCGACAGCCTCCTTATAGTATCC
AAGCATCTCTCTTGCCGTGCCTCTTCGCAAGTAAGCTTTGACAATCTTTGGATCAATATCGATGGCGCTAGTGCAATCTGTCTCAGCTTGGCGATAATTA
GCTAGTTCGAGAAAAGCCGCAGCCCTGTTACTGTNGTATGTGGCTACTTTGCCATTTAATTTGATTGCTTCAGTATATAAATTTATTGCCTTTTGCCATT
GCTTCTCCTTAAATGCACTGTTACCTTTCTCTTTNNNAGCTTCAGCAGCTTCTTCACTCATCGCCTCTTTACTTGAGGGANNNNNTTTTGCTAGGATCTC
AACTTGCTCTTGGATGGTGGCATATATGGCTTGAGTGGTGTCCAGCAAAAAGCGATCACCACCATGCCTCGCAAT
page-top