Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6996  (registered. 2012)
Contig Information
Length 1080 bp
Clones alternative view 131 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XE Seedling, infected with leaf rust 10
WH_XF Seedling, infected with leaf rust 16
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 14
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 64
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|232196|sp|P30110.1|GSTF1_WHEAT|GSTF1_WHEAT RecName: Full=Glutathione S-transferase 1; AltName: Full=GST
Score 463
Evalue 2.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6996
TTTTTTTTTTCCTAACGGGCACACATGTGCCAGTTATCCCTGTCCATATATATTTGCATGCAAATGCACACGTATCCAAGATGTATATATATACTGATCT
CTAGTGGGGTACTACTATATAGGACGTACAGTACGGATTAGCAGCATTGACCAGTCCGTTGTTTATTTACTAACTAGTACTAGTGCATAAATTAAAGCAA
GGAATCCAGCGCACGAACAGAAGCGCAAGCGGACTCCTCGTGCTGCTGAAACTGAAAGCGTATACTACTGGAAGTAGACGGGCAGATGATCACCCACCCA
CGGGAGGGAGGTCTCTTTTCTTGAACGGAATCATCACCGGCACGGCACGGCACGGCACGGCACACACCCGCGCGGAGTGCATAAACACCTAGTACTGCGC
ACCTAGCTTAAACTCGGTAGGCATATGCTTGCAGACCCTCTGCACCGCCGGCCTCGCCATGAGCATCTCCCACCAGGCCTTCACCTTGGGGTAGTCATCA
AACACCTTGGCGTACGGGGTGGTCATGAAGTAGAAGGTGAACGGGATGTGGTTCAGATCGGCGAAGCTGATGGAGTCCCCGGCCAAGTACCTGCTCTTCT
CCAGCCGGGCCTCGTAGATCCCCAGCACACCCCTCAGCCGCTCCAGGCTCTCGTCCACGACGGTCTGGTTCGGCGCCGCGCCACCGCCAGGGATGATGAA
GGGGATGATGATGCACTCGAACACCACGGGCGAGATGGCCGGGTAGTACTGCTGGGCCTCCACCTCCGTCCACACGTCCACCATTGCTAATTCTTCGATT
CCGCTGTTTTCTCCGAGGAGGTCCAGGCCGGCTGTCCCCCCGTACTTGCGGAGGATGTACTTGGCGATGGCGCGCGACTCGAACAGGACGAGATCGCCAT
CTTGGAACCCAGGCATCTTCGCAAACGGGTTTAGCTGGACGTGTTGGGGCCTCTTGTGCTCGCCGNNGACGAAGTCCATGGGCACGAGCTCGTACTCGGC
GCCGACCTCCTCCAGGAAGAGCAGCACCCGTNNNACGTTTGTCAACATCGGGTGCCCGAACACCTTCACCGGAGACATGT
page-top