Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16460  (registered. 2003)
Contig Information
Length 1060 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 387
Evalue 2.11238e-35
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16460
TTTTTTTTTTGTATTAAAACCAGAAGAAAATGTATCGACATCAATATCAATAATGGTACAAAAATATGGGGACAAGGGTGTATGATGATATTTAACTCGG
GATGAGGTTTCTACAAGGCAAGCTAAATAATAAACACATATCTGACATTTCAACCTCGGTACCATCCATGAGTTTTAAATATACAGAGGGGCTACACAAA
TGATGAGTTCTTGATTTGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAAATTAAGACAAGCAATTGGAACTGTAATCCAACACTTC
ATTCACAGGCCTTCCTTCCACCCCAGCTTACTGCAACATCGGCAAATGGACTCTCCAGGACCAAATCAGAAACTCCCCCTCAGGCTCGGCAACACAGGGA
CGAACATAGTACCGTTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCATGCTTGATTTGATCCCGAATGCGCAACTCTAGGATACG
CAGAATAAGAGAATTCACCCGTCCTTCGCTATGAACCACCACGGTTCTGATTCATGTCAGCCTGACCGCTGGCATCAGGTGCTCCCATGGGCAGCTGATA
CTGAGGCGGCAATGATGCTGGTGGTGCTCCTGCCTGGGAGTAGAATACCTGTGCGCGGGGATCAGCAGCATACTCGGGGTACCCATAGTTTCCCGCCATG
GTCGGCGGAGGCTGCGATGCAGGATGGTGGTGGGATTGCATTACATGGTGGTACCCCATTCCAGCATAATTAGGGGCCGTGTTAGCCCCTGGAGCAGGGG
CAGCGGGCGCCGCGGTTCGGTACATGCCAGGCTGCTGCAATTCAGGCTTCATATATTGCTGAGGAATCGGCACGGTTGGCTTCGGTACGCTGTCAACAAG
TGTCGGGGCAGCCATAGGGGCTACAGCACCAGCAGGAATGCTATACTGCTGAGGTGCATTTGGACGCTGCATAGGGATGTAATACATGCCAGTATTTGGG
TCAAATGCAGGCGACTGCTGTTGCTGCGGCGCTTGCTGAGGGACAGTCTGCTGGTAATAA
page-top