Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16447  (registered. 2003)
Contig Information
Length 1530 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 3
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit putative acyl transferase 3 [Triticum aestivum]
Score 2184
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16447
AGCAGAGCGAGAGCGGCCATGGCGTCGTCGAGCTTCAAGGTGACGCGGATCTCGGAGGGCGCGGTGAAGCCGGCGTCGGAGACCCCCGACCACACGCTGC
CGCTGGCGTGGGTGGACCGGTACCCGACCCACCGTGGCCTGGTGGAGTCGATGCACATCTTCCGGTCCGGCGCCGACGCGGCCCCCGCCGTGATCCGCGA
GGCGCTGGGCAAGGCGCTGGCCTTCTTCTACCCGCTGGCCGGGCGCATCGTGGAGCAGCCGGAGAAGGGGTGCCCCGCCATCCGCTGCACCGCCGACGGC
GTCTACTTCGCGGAGGCCGTGGCGGAGTGCAGCCTGGAGGACGTGCGGTTCCTGGAGCGCCCCCTGCTGCTCCCCAAGGAGGACCTCGTCCCCTACCCCG
CCGACGATCTCTGGGGCGTCGAACCCCACAACACCATCATGATGATGCAGATCACGAAGTTCACCTGCGGCGGGTTCGTGATGGGCCTGCGGTTCAACCA
CGCGTCGGCGGACGGCATGGGCGCGGCGCAGTTCATCAAGGCCGTGGGCGACATGGCGCGGGGGCTCCCGGAGCCGGCGGTGAAGCCGGTGTGGGACAGG
GAGAAGTTCCCCAACCCGAGCATCAAGCCGGGCCCGCTCCCGGAGCTCCCCGTGCTGGCGCTGGACTACATCGTGCTCGACTTCCCCACGGGCTACATCG
ACGCGCTCAAGACGCAGTACAAGGCGCACAGCGGCAAGTTCTGCTCCGGCTTCGACGTGCTGACGGCCAAGCTCTGGCAGTGCCGCACCCGGGCGCTGAA
CCTGGAGCCGGACGCCACGGTGAAGCTCTGCTTCTTCGCCAGCGTGCGCCACCTGCTGAAGCTGGACGCGGGGTACTACGGCAACTCCATCTTCCCCGTG
AAGATGTCCGGGACGAGCAGGGAGGTGCTGAGGTCGTCGGTGATGGAGGTTATCGACATGATCCGGGAGGCGAAGCAGCGGATGGCGGTGGAGTTCTTCC
AGTTCGCCAAGGAGGAGACGCGGCAGGACCCCTTCCAGATGAGCTTCGACTACGAGTCCATCTACGTCTCCGACTGGAGCAAGCTGGGGTTCTCCGACGT
GGACTACGGCTTCGGCCCGCCCATGTTCGCCGGCCCGCTCGTCAACAACGACTTCATCGCCTCCGTCGTCATCCTCAAGGCGCCGCTGCCGCTGGACGGC
ACCCGGATGCTCGCCAGCTGCGTCACCAAGGAGCACTCGGAGGAGTTCGCCCGCGGCATGAAGGAGGACCTGCCATGAGCGAGCTGCTTCGCTTTGCTTT
GCTAGACGACCGAGAGAACCTTGGCATGCATGCAGGGGGATGGGGATGGAAGCATCGTGGAGCTCTGCTGATGCGGTTGCTTGGTTGATATATTGGTGCT
AATGTTGTTGTATTTGTACCTGTTTTCGTTGTATTTACTTACTTTGTTTCTACATCTTTTGAGCAATACGTTACCATTCTTAGAGTGTAGACAGCCAATT
TGATTTTTTTAATCATTGATACGAGACAAT
page-top