Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16444  (registered. 2003)
Contig Information
Length 1004 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsI_12569 [Oryza sativa Indica Group]
Score 798
Evalue 2.13084e-85
Total Hit Count 71
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16444
ATCATTCACATGATAAACGTTAGACAAATACATACAACCTATGAGTACAACGGATGCCTAATACCCAGTATCCACCATGCTACCACGAGATTAGCAGCAA
GAACAACATGTTTATTTTGTATACGACACAATAAATAGAAGGAAATAAAATATATTGTTCACATTGATATGTAACACTAACTTTACACCCGAACGCCTTC
GTTCCGACTTTACAAGAACTACAACAGGAGCTATGGCCCAGAACTCCCTGTTTCATTGTCAGGAAATGCCCCAAACAGCAACTTCTGCGGCCTCTTGGCC
AGTGCATTTCCATCCTCTTCGCTGATGGATCTCAATAAGCCAGCGAAGCTTTCTCAAATAAAATGATTGTCATCAATGGGGAAAGACCCCACGTCGCTAG
ATATTCTGAGAAGGTGTGCCAGCTCTAACCGGTATTCCAGACCCCGGATGTAGTGACCCAGCAACATGCACCAGAATAGCAAACGTGCAAGATAATCACG
TGGGACAGATATTAGGGGCTGAAACGGGAGGGAAGTATTCTCGACAAGCTCTGCACAGTCATCGTCCTCACCCCCACGATTTAGGGCTCCCCCAGCATTC
TCTAGTGGCGGAGGAGACTTTGAGTGTACCTTGGGGGAAAGAGTAGCAAGCAAACCATGCACAACAGACTGGATAGCCTCTTGCACACCGGGACAGGTGG
ATTCCGAGAGTTCAGCAACCTTCTCTGGTGTTAGGGATCTTAGATAGTCTAGCAGATCATTTTTCTCTTCTCCAACAAACTGTTGCATTTGAAGGGCAGA
ATTTTTCCTCTTCAGGTCATGCAACTCCTTTTTCATCGCATCCAAACGAGATTGCAACCGAATAATCTGCTCTTCCACTTGGGGTGTTAAGTTACTTAAC
ATTTCCCCCATACTCTCACCAGATGATTCTTCGTCACTTTTTCCAGAGTCCTGGGGGCATGTCGTCTTCCGATAATCTGAAAATTGTAACAGGCCTACCC
AAAT
page-top