Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6987  (registered. 2012)
Contig Information
Length 1068 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657845|gb|AAB18202.1|| cold acclimation protein WCOR410c [Triticum aestivum]
Score 461
Evalue 7.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6987
TTTTTTTTTTACAACACAACAATATATTTCTGGCAAAAAAAAACGCAACAATGTACGCTATATATCTTCACAAAATGCAACATTATGTACTGGGCGGAAA
TCTTTAATATCAAGGCATAATGCCCAGCAAATAACCAATACACAAGCGCCCATAATAAGTAAACAAACTTAACAACATCCAGGACCTGACTCTGAACCAA
ACTGAAACACAAGCATCCGTCACTGAACGGGCTTCACGGACCGAACCTTCAAAGACGATCAACCCCTCCCACCTTGACACCAACTTAACGTAAAGCAAAC
ACAACACACGCCAACAATTCAATCGAGGTCCGGTCACGAGTCTCGGGCACGGCGGCGATCAAGCGCTGGGCTTGTGCTCGCCTGCAGCGGCGGCGGCCTT
GTCCTCCTCCCCTGTCTTGTGGTAACCAGGCAGCTTGTCCATGATCTTGCCCAGTAGGCCCTTCTTCTCCTTCGCGTCAGGGCTGCTCACCTCCTCGGCG
GCTGGCGCCGGCGCGTGCACTGGTGCTGGAGCAGCGTGCGTGACGGGCACCGGAGCAGCGTCCTCCGGTTTCTTGTGGCCGCCGGGCAGCTTCTCCTTGA
TCTTTTCCAAGAAGCCTTTCTTCTCCTCCTCGGGCACTGCCGGTGCCGCCTCTGTCTTCACGTCACCGTCGATCTTTTCGACGACGACGTCGGTGTCATG
GTGGGTCTGCACAGACGCGGGGGCCGCCGGTGCGGGTAGGCCCGTCACGTGCTCACCCTCGGTGTCCTTGTGGCCGGGCAGCTTCTCCTTGAGCTTCTCC
TTGAGACCCTTCTTCTTCTTCCTCTTGATCACCTCACCGTTGTCATCGATCACCTCCTCCTCTTCCTCGTCACTAGACGAGCTGGAGCTGGAGCTGGATC
GGTGCAGCTTGGAGAAGAGGGTCTCCTTCTTCTCGCCATCCTCGTGCTCCTCCTTCTTAACCTCGGGCTCTTCCATGGAGAAGGTCTCCGTGCCGGTGAC
CAGCTCCTCCTGCTTCTCCTTGTCCTCCTCCGCCTTCTTCTTGCCGAGGAGGTTGCCGAGGAGGCCCC
page-top