Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16402  (registered. 2003)
Contig Information
Length 1197 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_RDr Root of dessiccated seed 3
Homology (BLAST) Top Hit senescence-associated protein DH [Zea mays] >gi|54208706|gb|AAV31120.1| senescence-associated protein DH [Zea mays] >gi|194700856|gb|ACF84512.1| unknown [Zea mays] >gi|195639304|gb|ACG39120.1| senescence-associated protein DH [Zea mays]
Score 959
Evalue 1.1949e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16402
CGCCCCCTTCCCCAAAAACCTTTCGAAAACCGCCGCGCCAACCGCCAACCGCCACCCGCCCCCGTCCAAGAAACCGCACGCCGACGCCGGCGCCCGGCCA
AGATGGTGCGGCTGAGCAACACCATGATCGGGATCCTGAACGCCATCACCTTCCTCCTCTCGGTGCCGATCCTGGCGGGGGGCATCTGGCTGCGCGCGCG
CGCCGACGGCACCGAGTGCGAGCGGTACCTGGCGGCGCCGGTCATCGTCCTGGGGGTCTTCCTCATGCTCGTCTCCATCGCGGGGCTTGTCGGCGCCTGC
TGCCGCGTGACATGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCATCACCGTCTTCGCCTTCGTCGTCACGCACA
AGGGCACCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACCGGCTCGGGGACTACTCCACCTGGCTGCAGAGGCGGGTGGAGAACGACAGGAACTG
GAACAGGATCAGGGGGTGCCTCCAGGACGCCAAGGTCTGCAAGTCGCTCGAGGACAGGAGGGACACGGTCCAACAGTTCATGTCCTCCGATCTCTCCCCC
ATCCAGTCCGGCTGCTGCAAGCCTCCGATCAGCTGCGGCTTCACCTACGTCAACGGCACGCAGTGGAGCGGCCCGGCCAAGTCGACGGAGCCCGACTGCG
GTGCGTGGTCCAACGACGACGGGGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGCTCAAGCGCAACTGGAAGCGCTCCGCCAT
CATCAACATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTAC
AAGCAGCAGGGCGCGTACGCTTGATCGCGCGCTTGGCTCGGTTATTTATTGCTTGGATTGGATGGATGCGATCGTCTCGTCGTGTCATGCATCTTCGTCG
TCGTGTTTCTCTTAGGATGGCCTGATCTAGCTTTGTACAGGCGAGATGTGCTCTGATCACCTACTAGTTAGGTTTTACTCCGTGGTCATGAGGAGGGATG
TGTATATATATTTTCTGTTCTTTGATATTTATTATCGCAGACCATTATATATGTAACAGATTATTCTGGAGTTATTTATTTCATATTAAAAAAAAAA
page-top