Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16397  (registered. 2003)
Contig Information
Length 957 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_09304 [Oryza sativa Indica Group]
Score 593
Evalue 2.32155e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16397
TTTTTTTTTTGATCAAATACAACAAGACTTAAACGGGGGGAAGAACACATCTCATCATATCAGTGATCAACGAGGCGATGGCTCATCACATGAGACAACT
CAAGTTACACTGATACAATAACACAATAACCAGAGAATGGTTTCTTTTACAGACAAAACTTAAACAGGGGAACAACATATCTCATCTCATCTCATAATGA
GCCTCAAAGCCCCCTGGATGCACGCTACTGACTCCCTTACCACCCTAATTAAGCTCCCAACATATATTTACAGGTGCCTCACAATTCACAATGGCGGGTG
AGATCTCCAGGTTCGTTGGTTTTATTCCTCCAAGGTAACAATGGAGCCACAACTGGCATGTCGACGACGACGGTGGATCGGTACTTACAGTTGACACTCA
GCAATGCAGAAGAAGAAGAAGGCGACAATGGCGCGCCGTCGTCGGAGATCACTGGCCTTCCAGGAGCACCCTGAGGCTATGGAGCCCCTCGGCCGAGATG
CTCCGCTCGACCCTGCCCGCCCTGTTCACCCTGATCTGGGGAGGGGCCTCCTGGTGGAACGAGACCATGACCGCCGTCAGGTTGTCGGTGGCGCCCCGCC
TGATCGCCTCCTCCACGATCTCCTTGCAGCACCGCCGGAGGTCGTTGTGCTCCTGGAGCCTCCGCCGCGCAAAGTCCACCGAGTTCTGGTTGGAGAAGTA
NTCCCAGATGCCGTCGCTGCCGATGATGAGGAACTCGTCGTCCTTGGTCANCGTGATCATCTTGAGCTCCGGCTCGGCGCTCANCGGGCCTCCCGGCTTG
CCCATCTCCTTGANGCCNTCNAGGTGCCANTCCCCNANCGCTCTGGTCACCNCTANCTGGCCNTTCANATANNCNTCNNCNACNTANCCNCCTANANATT
CNACNCNCTTTCTTTCNNTCNNGNANNANGNTCTGNGNNCCTTNNANNTTTNNATTG
page-top