Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig698  (registered. 2012)
Contig Information
Length 596 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_DPA20 Seed DPA20 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218200180|gb|EEC82607.1|| hypothetical protein OsI_27181 [Oryza sativa Indica Group]
Score 362
Evalue 1.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig698
CAAGGTCCTGATCGTGCATTTGGGGATCTCATTTCTGCCTCTGGGATTACGGAGGAGATGATTGACAGTTTGATCCTCTTGAAGGATGCCAGGGGAATAC
CAGGATTGCCTCCTCTAAGTGAAATACAAGATAGAGCTATCCAGAAAATGAATGCAACATCAAGCAGGGCAGAAGTAGAACGCCAAATGCAAGAGGAAAT
TGCCAAGGCACGTGTGAGACAAGTTGATGAGAAAGGAAGGGCTTATGGTACAGGTAAAAGGAAGTGCAGCATTGCCCGTGTTTGGATTCAGCCTGGTGAT
GGCAAGTTTGTTGTCAATGACAAGCAATTTGATGCTTACTTCCCAATTCTGGACCATCGAGCTGATCTTCTTCGGCCATTTACTGTGACCAAGACGTTGG
GGCTTTGGGACGTAGCTTGTACTGTGAAAGGTGGTGGTGTCTCAGGTCAAGTTGGAGCTGTGCGCCTAGGAATCAGCAGAGCCTTGCAGAACTGGGAACC
AGGACTANGCCCATATCTCAAAGCAGCTGGATACTTGACCAGAGATTCGCGTGTGGTCGAAAGGAAGAAGCCTGGAAAGGCAAAGGCAAGGAAGAG
page-top