Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16320  (registered. 2003)
Contig Information
Length 2163 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 3
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsJ_008425 [Oryza sativa (japonica cultivar-group)]
Score 2258
Evalue 0
Total Hit Count 415
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16320
GGCTTATTGCTGCCTGTAGTGAGAGCTTAGGGCCTGTAGATACTTATGTGTACCTTTCTCCACATTTAAGGCAATTTCTACACAGGGAGCCACCTTCATT
GTCTGAAACTGCTCTTCTTGCATGTCTTAAGCCTCCAGTCTCGAAATCAGTCTTATACCAAGCTTTAGAGCTTGCCAAGGACACAGGAGAGGTTTTACTG
AAGGGTGATGTTAAAAAGGAACAGATAGTACATGGTGGAAGATATCCTGCTACAACACAAAGTGTGTCCTCTGCCGCTCTGGAAGATGCTGTAAGGTTGA
GAACATCTACTTTGGACATCAAAGATTCAATTTCTTCGGATAAATCATTATATTATGGCTATGCGCCACATGCATCTGCTGGGAGTATTTCATTTTATGA
TGGATTGTCTAAAGGAATACCATCATATTCTGTTAATACTGATAAGCGTGGTTTAGGAGAAATATATATGCCCTGGGAATCCAACCGGCATCCAGGTTTA
TCAAGTTCAGTTCAAGGTTTCCAGACTAGAGAGAATCATTTCAGTAGCAAGCATGGTGATTTAAGCATCAGTGACCCACGGAAGAGCAGCTCCCCTGTGC
CAGGTGATGGTGGTTCCAACTCTGAGACAGCAGTATCACCCTCCTTCACTAGATCATCAGTGGCTCTGGAGACAGGTTGGAAGCCTCGTGGAATTCTAGT
GGCACATCTCCAAGAACATCGCTTGTCTGTCAATGATATTTCCGTGTCAGACGACAATTCCTTTTTTGTGACGGCTTCGGATGACTCGAGTATTAAGATA
TGGGATACAAGAAAATTGGAAAAGGACATTGCCTTCAGATCTAGGTTAACCTATAGCTTGGGTAGTAGCCGAGCTCTATGTACTACAATGCTCTGTGGTA
GTTCTCAGGTCGTTGCTGGTGCTAGCGATGGCACATTGCACTTGTTTTCTGTCGACTGTGCACGTGGAGCTGGGAGTTCTACAGAGAGGTATTCTGGCAT
TGTTAATGTAAAAAGGAAAGATCTGAAAGAAGGTGCAATCCTCAGTGTTGTAAATTGTTCATCGGATAGCTTTAGCCCAACCATCCTTTTCAGCACTGAA
CATTGTGACATCCATAAATGGGATACAAGGTCCAATTCAGAATCTTGGTCATTTAAATCGTCACCAGAGGAGGGTTATATCTCGGCACTTGTGATGGGCC
AGTGTGGAAATTGGTTCATCTCAGGGTCTTCAAGAGGTGTTCTTACATTGTGGGATCATAGGTTTTTGCTGCCTGTTAACTCATGGAACTATTCCACAGT
AAGCCCTATAGAGAAATTGTGCTTGCTTATACCACCACACAACTCAATATCTTCTAGTGGAAGACCACTCGTTTTTGTGGCTGCGGGCTGCAATGAAGTC
TCCTTGTGGAATGCTGAGAATGGTAGCTGCCACCAGATGTTCAGGACAGCAGGCACCGAGAATGATGCTGTTACGCCAAAGACACCATCAAAACCTCTTA
ACAAGACAACCGCCAAAGACGTGAGGCGAGCAGGAAACTACAAGTACAGAATTGAGGAACTGGCCGATCCGCCTCCACGCCTTCCAGGCATCCGGTGCCT
GCTTCCTTTGCCAGGGGGAGATCTGTTGACCGGCGGAACAGATTTAAAGATACGTTACTGGGACCAGGCCAGACCTGAGCAAAGCTTCTGCATCGCTGGT
CCTTCAGCAAAAGGAGTTGGAAACGACGAGTTTTACGACATACGATCCAGCTATGGTGTACAGGTTGTGCAGGAATCGTGCAAACCGCCTACACCGGCGT
CCAGATTGACGCACAAGACGCAGCTCGCGATGGCCGCCGCCGATTCTGCCGGCTGCCACCGGGACGCGATCCTCGCGTTGGCCTCCGTCAACTTGTCGAG
CCAGCGGTTGATATCGGCCAGCAGAGACGGCGCAGTCAAGGTGTGGAAATAGCTACTCCGGCCTGGGTAAGCCGGCGCCTTCTCCCACGACGACAAGCAG
GCAGGCCCCTTGGTGTACATAAATATTTAGCCTCGTGACACAGTAGTACGTATATATCACGACTCACTGTTGTAGTGTTGTACATATGGCGATGATGTTA
ATCAATACAGTACCCTGGCCATTTGGGTTAGCGTAATAACCAGTCGTTTGTTGAAAAAAAAAA
page-top