Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16177  (registered. 2003)
Contig Information
Length 938 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Homology (BLAST) Top Hit H0820C10.3 [Oryza sativa (indica cultivar-group)] >gi|218194291|gb|EEC76718.1| hypothetical protein OsI_14737 [Oryza sativa Indica Group]
Score 672
Evalue 3.16929e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16177
ATATGATCCCACAATACATACCACTCAGCCATGCATGGTCTAGCTCTAGCTCTAGCTCTAGCTCTAGCTCTAGCTAGCTAGCACATCATCCAATCCAAGC
AAGGTTAAGCTAGGTTCAGGTTGGTTGGTTCAACAACGCCAACACCACAAACGGTAACATCCATGGGAACGTTCCCAGCGGCACCCGACACAACGGACCG
ACTTACGGGCACCCTGGATAACAGCTAAAGTTCCAGGTGCCATCTAGATAGTACATAGATAGATAGGTACTAGTAGGTTTTATTTATACAGACGCACGGT
TCAACCTCCACTGACAGAAAGCGGCATCGATCAAGTTCAAGAGCAGCATCAGATCAGCAGAAGAACATGGAGCTCCTCACTTTCTCGTGCAGCCGAGGCA
GCTCCGGCACCGGGGCGCTGCCCGCAGACGTGTGGCCCCCTCCCTGGCTCGACGACGTGTCCGACATGTCCTCAAACTTCATGAAGGTGCCCACCTGCGC
CGCCGCCAGATGCGCGTACGCTATCGGAGCAGCTACTGATATCGCCGTCGTGCTCCTCTGGTACACATAGGAGAGCGAGTGCACAAACTCCTGGAGCTCA
TCCCCACTGAAGCCGATCTCATCATGCAGAACATGGTAATGCGTTGGCCTCGACGTGCCAATCATCCCAGCATGCGCGCACATGTAGAAGTCAAAGTTCT
TGGGATGGCACACTTGTTTATCCACCACAGTGCCAGGAGGAACATTTTCTGGCGAGTTTGTCTGGAAAAACCTGGTATGATGGTTTTTCTGAGCAACAAT
GACCGTGAAACTTGGGCTCCCACTTGTCGTCAAGGCACTTGCATGCCTCAAATGATCTGCTCAAGCTCAATGTTTATGACCTGAGTAAACTGGCTTTCGC
TAACTCCATCCCTGAAAATGATGACTTGGTCTGGCTTT
page-top