Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16139  (registered. 2003)
Contig Information
Length 548 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 5
Homology (BLAST) Top Hit predicted protein [Botryotinia fuckeliana B05.10] >gi|150852469|gb|EDN27661.1| predicted protein [Botryotinia fuckeliana B05.10]
Score 89
Evalue 0.20509
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16139
ATGCATTACAAAGTGTAACCGATGCATTCCAGGCTCAACAAGACATTCACCAAGCACATTGAGGTGCCTAACATCACAAACAAGCTCCTCCACGCCAAGA
ATGCGTCGCTTACAGCCTCTGGATACAAACCAAAGTAGAAGGAAGAAGAAACAGAGACGAAACAAGAGGAAGGGAGGATATTCTCGGAGGAGGAACAAAT
AACTAGTTAAAAGATGCCTAGAAAAGAGAGAGAGAGAAAGAGAGATATACATATATCTCGGACCATAACGCCTCAATTCCCCACCGCACGCTCGCACCGG
CCGCCTCATGCATGCTCGCAGAGCAGAGCAGAGGAGGACGACGCAGTGAGAGCACAATGCGAGCCGCTAGCTCGCGCGCCCGCCGTCTCCTATCTGCAAG
GCTCGTCGCCGTTGGACTCGTCCGCTCCCGGGTCTCCAAATGCTGGCCAGGATGCACCGTCTGCAGCTGCAGAAGCACCGAGGAGCTCCATTGCTGGGGT
AGGAGGAAGATGGGGCATTTTCTTGAGAGGAGGAGATTACTATTCAAG
page-top