Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6956  (registered. 2012)
Contig Information
Length 847 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115460894|ref|NP_001054047.1|| Os04g0643000 [Oryza sativa (japonica cultivar-group)]
Score 441
Evalue 6.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6956
CCATCCCCTCCCCTCCTCGCCGGAACCCTAAGCAGCAGGGAGGGCGGATCGCCGCGGCGCGGGCGCACGGGCGGCGGCGATGAATCCCCAGCGGAAGCGC
ATCCCCAAGATCGAGCCCTTCAAGCACCGGGTCGAGGTCGACCCCAAGTTCTTCGACAAGTCGTGGAAGAAGCTCGATGACGCCATCCGCGAGATTTACA
ACCACAACGCCAGCGGCCTCTCCTTCGAGGAGCTCTACAGGACCGCATATAACATGGTTCTTCACAAGCATGGTGGGAGGCTATACGATAAATTGGCAGA
GAACTTGAAAGGACACCTTAGAGAAATGGGCAAATTAGTAGAGGCTGCCCAAGGTGGTTTGTTCTTGGAGGAGCTACAGAGAAGGTGGGCTGATCATATC
AAGGCTTTACAGATGATCAGAGATATACTGATGTATATGGATAGAACATTTATTCCATCTAGCAAAAAGACACCTGTCTTTGAGCATGGTCTAGAACTGT
GGAGAGATATTGTTGTCCGCTCCCCCAAAATTCATGGGAGATTGGTCGACACACTTCTGGAACTCATTCATAGAGAGAGGATGGGTGAGATGATAAACAG
AGGTTTGATGAGGAACACGACCAAGATGCTGATGGAACTGGGGTCGTCTGTCTACCAGGATGACTTTGAGAGGCCATTCCTTGAGGTGTCTGCAAGTTTC
TATAGTGGTGAGTCGCAGCAGTGCATCGAGCGTTGCGACTGTGGTGAGTACCTGAAGAATGCTGAGAAGCGGCTTGCTGAGNAATCGGAACGTGTTTCGC
TGTATATGGACGCCAAAACTGCAGACAAAATAGCTAATGTTGTGGAC
page-top