Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16076  (registered. 2003)
Contig Information
Length 861 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit Os09g0375900 [Oryza sativa (japonica cultivar-group)] >gi|49387690|dbj|BAD26036.1| hypoxia-responsive protein / zinc finger (C3HC4-type RING finger) protein-like [Oryza sativa Japonica Group] >gi|113631273|dbj|BAF24954.1| Os09g0375900 [Oryza sativa (japonica cultivar-group)] >gi|125563505|gb|EAZ08885.1| hypothetical protein OsI_31148 [Oryza sativa Indica Group] >gi|125605501|gb|EAZ44537.1| hypothetical protein OsJ_028020 [Oryza sativa (japonica cultivar-group)] >gi|215765284|dbj|BAG86981.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768257|dbj|BAH00486.1| unnamed protein product [Oryza sativa Japonica Group]
Score 402
Evalue 2.77137e-37
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16076
TTTTTTTTTTGGGGCGGAGTCAACGAAGAAAAATATTTATTCTTAAGCCTGGAGATTGAGCCAAAATTACTTCTAGTTAGAAACCACATGCCAAGCGTGA
ATGACAATAGTTAATCCCCAGGACCGGGAGGCGATCGAACAGCAGAGCCCCAGGTGAAACTTAAGTACATAAGATATGCCATTCCGTACTCCACAACCAC
TATCCAGTCAAGTTCATGGGCTAGACCCTTTCTTGAACAGCTTGATTTGGTCACCATAGTAGTACGCGCTGCCGACCATCAGAGCAACCGTAACGCCTTG
AGCAACCACACGGGCCCTCATCAGCTTCTGACCCAGCCGAGAATTCCCGTACCGGAAGCTGACCAGGCCAGCTGTCAGGACACCCGCAGTGACCAATGCA
CCGATGGGGACGAAGGGGTTCTTGACGGGCTTCTTCCCCTCGAACGGGAACTCGTCCAGCTGCGGCATCGGCGGTGGCCGCGCGCTGCTTCCTGCGGCGG
CGCCGGAGCCCTTCTCCATTCGCGTCGCCTGGGAGGAAAAGGGGGGAGGGGGGACGCTTTTCCGAACTCGAGGGAAGTCCTTATAACTTTCTTCTTCTTT
TGTTTAAAGCAGCGAGGGTGCGATGAAGAAGCTGGATCTACTCGTCCATCCTCATGACGCAGCGAAGTCCCTCTCCCTTGAGCATGAGGTCGAAGGCCGT
GTTGATCTGCGAGAAGGGCACGCTGTGGGTGATGAACTTCTCCACGTCCANCTCCTTCCTCATGTACATCTCAACGACTTCCGGGAGGTCGGTACNCNGC
TTGTANTTGCCNAANAAGGTGCCCTTCAANGTCCTCTCATTGANGAANTTCATCNGNTGGG
page-top