Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16023  (registered. 2003)
Contig Information
Length 898 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit Os02g0721700 [Oryza sativa (japonica cultivar-group)] >gi|45735979|dbj|BAD13008.1| unknown protein [Oryza sativa Japonica Group] >gi|113537493|dbj|BAF09876.1| Os02g0721700 [Oryza sativa (japonica cultivar-group)] >gi|215678963|dbj|BAG96393.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692557|dbj|BAG87977.1| unnamed protein product [Oryza sativa Japonica Group]
Score 583
Evalue 3.03702e-58
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16023
TTTTTTTTTTGAATTCTAAGTTGGCAACCAGGTGAGATTCCAAAGAATATGTAATCTGACATAGCTTCAAATTACAAGATATTGCAAGAAGGAAAATTTC
AAGAGCGCCTTAAGGAGCAGCAGCGGATTCAGGCTCAACATCATTTGAAAAACATGGAAGAAATAAAGGTATCACCACCACCACAACCACCTACTGGAAG
AACAATGCTACTAGTCCACACATGAGAGTAATCAAAGCAAGCGAGCTGCTTCGAGCCCTTTGGACACCACTTTTAACAACGTCTTTCTGGGGGACACCTT
CGCAAGAAAGACCTAACTTGCCTTCTCGGCACTCGTGGGCAAACAGGCCTGGTGGGTACTTGCCATAGAGGTTGATGTAGCTGAACATTGTGGATGCACA
GTCATTGCTTTCATCATTGATGTAGTTATTAAACGGGCATGCAAATTCCTTGAAAGAATCACAGCAGTCTTTAGGAGGATATTTCGGCCCTTTGCACCTG
CTTGTGATGACGGTGTAGTTTTGGAACTCGAAGTTCACAGGACAATCCCTCTTGGCCTGCAGCAAGGTCCTCCCCGTGGTAGATCCGGCGCTCGCCTGGA
ACACGCCGTCGGAGATGAAGGGGGAGGCGGAGGCGAGCCCGACCAGGAGGGCGGCGAGGACGAGGAGGAGCGGGAGCCCACGGCCGGTGGCCATCGTCGC
GCGTCCCTCCGCCCGGCGCACGGCTCCGAGCAGGGACAAAGGCTGTTGGATCTAGGAGGACGACGACGACGGACGGCGCGCGCAGACCCACCCACGTGCG
CGCCTCGACTCTCCTCGCTGGTGGCTTGTAAGCTCCATCGGAGCGGGCGGGCGGTGCTACAGCTGCAATTAATTAGTGGCGACGGATGCTGCTGTGAC
page-top