Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6938  (registered. 2012)
Contig Information
Length 900 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32401369|gb|AAP80856.1|| probable light-induced protein [Triticum aestivum]
Score 231
Evalue 8.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6938
TTTTTTTTTTGGGTGAACCAATGCTGGAAAGATGGATACAAGTAACACATCAGTGGCAGACCTACCACAAAGCCAGTAACCAACTCCAAGCTGCTCAAAT
ATGCAACAGCCAGGTATGTAAGTACGTATCAACCAAGAATGCGGAGCATGTAGGTTATCTCGAAAAACAAAAAGGACGGCATAACTTTCTTCGACGCAAG
GCCGCAAGTATGCATTCAATCTGTACACCTTTTTGCACAAAATGCACAAAGATTATTAATCTGCACGGAATTTTCATACTGCTCTGCTTTGTTCAAGGGC
GTGATTGACAAAGAAGTTTCGACATGGGAAAGAATGGACGGCATGGAAATTGTGCCGGCCCGCGGCCCAGAGTTCCGAGGCAGCAGGCAGGCTGTGCAGT
CGATTATTAATCCAGTCGGTCCTCGCTATCCTTCCAGTGATGCAGCAGCCACCTCCTTTCCATCATCGGAGAAATAATCTTTCCTTATTTTACGGGAAAG
CTGGTACAGGCCTGTGCCTGCCATCGCAACGTTGACGCTGAAAAGGTTCCAGTTTTTCGGTGTGATAACCATGCTGTAGCGTGACCAGACGACTCCAGTG
CAGGCAACCGCAATTTGCTGAGGATAGGATATCTTTTCTGGAGGCTTAGCAAAGTCAGCAATGTTCGCAATGCTGATCCCCCATTTAAATGTTGGAGCCC
AAAAATGAATGGTTTTGGGGCCAGCGGGATGGTTCAAGAAGGCTTGAATCTTTGAAGCCATTCAATCAAATGGATGCGCACTTTCCTCTCCTTGTGCACG
ACCCTGCCTATTTACTCTGTCCTGTACACCTGCAAGGGAGGGACGCCCGCCGCCGGTCGCCGGTCGCCGGTCGCCGGTCGCTGTCGCTGTCGCCGGAGCC
page-top