Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15928  (registered. 2003)
Contig Information
Length 863 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 436
Evalue 3.16351e-41
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15928
TCATATTTTCATATCGATCGCAAACATGCAAATGCAAGTCCACAACAGGGTTACATGCAAGCATACGCGTCCATTAAAAATAGGACAAATGCCGACAATC
ATCATCACTCGACTAACCTACAGTCTTATTTCATCACGATCATCATCCAGCTGAAAAAAGTAGGCTGGAGGATACGTAGTACCAATCTGCCGGCTGATAA
AAGATGCCAGAGCAAATACCTTAGGGAAGCTCAAAAGCGAGCTTCACATCACAGTAAGATCGCCACACAGTATATCACACGAGAAAGTCACAGGAGCAGA
TGAAGTGCTTCACATGCGGCTTCTCCATCGTCGACTAGCCAGACCAAGCCGCGTTGCCAACAGAGCTCAGCCCGTCATGGAAGGTGTTGTACTCTACGGG
CTGGCCTGCAGCCACCATCCGGCGCGGCATGTTCTCAGCATGATCGTTCAAGTAACCCATTCGAGCAGCCTTGTCAGCCATGTCTGCAGGGTGATTCTGC
ACGGACTGGGGTCCTAGATGATGGAGCATCATCGGAGCGCTGGCCTGCTGTGCTTGCTGAGGAAGGACAGCAACAAAAGTAGCAGCACTGTTGGGAGGGC
TTCCATATACAGTGTTGTAGGCCTGGGCACTACCCTGTACTGAATAGGGACCAACCTTGCATTGCTGAGGTGCAAATGAGCCATTGCTGGGCGAATGGAA
CTGCTGGGTCTGCTGCTGCTGGATGTGATGTTCTGCCATCGGAACAGCAATGGCGCTGCTTTGCACGTAAACAGGAGCAGCTTCATGGTGCTTTCGCTGG
GAAGAAGAGATCGTAGAGTAGGCAGGCTGCACAACCATGCCTCTAGAAAGTGCCTCGGTGTAC
page-top