Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15898  (registered. 2003)
Contig Information
Length 791 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os08g0425200 [Oryza sativa (japonica cultivar-group)] >gi|37572930|dbj|BAC98560.1| unknown protein [Oryza sativa Japonica Group] >gi|113623806|dbj|BAF23751.1| Os08g0425200 [Oryza sativa (japonica cultivar-group)] >gi|125561599|gb|EAZ07047.1| hypothetical protein OsI_29294 [Oryza sativa Indica Group] >gi|125603465|gb|EAZ42790.1| hypothetical protein OsJ_026273 [Oryza sativa (japonica cultivar-group)] >gi|215704566|dbj|BAG94199.1| unnamed protein product [Oryza sativa Japonica Group]
Score 622
Evalue 7.31204e-63
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15898
AGACGCCATGGTGTCCTCTCGCTGCGCCGTCCTGCCCCACCCTGCCGGAGTGGCCCCTCGTCGCCGGCAACACCTACCCGCACAGGCGTTCTGGGGGACG
GAGAGGAGGCGGCGGAGGCGGCTCGTGAGCTTCGAGGCGCCTTCTCGGTGCCACAAGATGTATGTTCCCGGCTTTGGAGAGGGCTCACCAGAGAAAAAGG
CGGCGATTAGTCTGCTGAACTTCTTCAATTACCTGGCCGTCAGGATTGTGCTGGCACAGCTTGAGAGTTACAACCGAGAAGCCTATGTTGAGCTCAAGGA
GTTCACCACCCGCAACTCCGTGAACGACGCTGATAGTTTCTGCAAAAACCTGATCCGCGAGTCGCCAAGACACAAGGCATTAGCTATGAGGATTTTGGAG
GTTCGATCGGCTTATATGAAGAATGATTTCGAGTGGGACAACCTGAAGAAGCTATCGTTCAAGATGGTTGATGAGGCCAACATAAAGCTCATGAGGGATT
ATGTCCTGGAGACCAGCCACATAGAAGACGACGAGTGAAGATATCACATGTATCCTCGGCACGTCCGCCGTGCAGGCCTCGATCGATCGACAGCTCTGCA
CACGCACATGATTTGGTTATGTTCTTTATTACCAAGTGCAGTTCAAACTACGTGTATTTGGGACTGGAAATGATCAGACAACATGACGATGCGCGCTAAT
GGGTTATACCACGCTGAAACTGAACCAGTGGTTAGGTCATATAGATATCACGGTCTCAGAGGTTGCTTATACGACATCCTGAATCAAGTAT
page-top