Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15883  (registered. 2003)
Contig Information
Length 530 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit GG21172 [Drosophila erecta] >gi|190657456|gb|EDV54669.1| GG21172 [Drosophila erecta]
Score 76
Evalue 5.89064
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15883
TTTTTTTTTTATTATAACATGCATGACAGTTGCATGTATTATATATTGTGCAAGAAAGAGAAGTCTTACAGGGTGAATACACGATCAGAACAGAGTTCTG
GTATTATTGGGTAAACATAACTGTGCAATCTGTACGTACGCGTACATACATACATGCACCTACCTTCTTATTGACCACATATACGAGTAGTTACTACGTG
CAGGCAAGTAGCAACGTCCGTGTGGAGCATCTGGCACTTAGTTGCGGACCTCCGCCCGATACATGGGCTCCGGGATCTCGTTGGGGCTTGCGCAGCAGCG
GCAGCCACCATGCCCGTGCCCACAGCACTGGTACCTGCAGCCGCTGCCGCCGCCGCCATGGTAGCCACCGCCTCCGCTGCCGCCGCCGTGGTAACCCTGA
ACACCGGCCTTAGTTTCTTCCTTCTTGGCCTGAGTTTGTTCAGCTGTGGCCACGAGGAAAGCCGCAGCAAGCAGGACAGCAAACACAACGAGACCCTTGG
ACGCCATGCTTGACACCCTCATCGACCGAT
page-top