Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6924  (registered. 2012)
Contig Information
Length 910 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 5
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_XV Leaves, plant was grown at constant 23 9
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|462081|sp|P00228.2|FER_WHEAT|FER_WHEAT RecName: Full=Ferredoxin, chloroplastic; Flags: Precursor"
Score 281
Evalue 6.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6924
TTTTTTTTTTGAGGAAATCGTGCAACTCAAAACTCATATTGAAACAAGTCGTAACATGCACCTATTATCTGCATAGAAGAAAGCCGCAGGTAAGATGTTC
ATCAAATTCCTGGAAACCAACATTCATTTTTTTTTTAATTAAAAAGAAGATATTATTAATCAGAGAGACTCCTCAGCCATCAGGATTCATTTCAGTACGT
TGAATTACGTACACGCTAGTATTACGACAGTAGTATATCTTACGGTACAAAAAGGTAATTCGGAGACATTATTACTTGACCAAATCACGCATCGAGCAAT
TCATTCGAGCACAAACAAATCGGAGTATCTGGCCATGTCAATGCATGCATGATAAGGAGATAATATGATATCAGCTCGATCTCGTTGCAAAGAGAGATAG
GTATAGCAGCTTATGCGGTGAGCTCCTCCTCCTTGTGGGTCTCGATGACGATGTCGGACTTGGGGTAGGCGTGGCAGGTGAGCACCCACCCGGCCTCCAT
CTGGTCGTCGTCGAGGAAGCTCTGGTCGGACTGGTCGATCTCGCCGGACACCAACTTGCCGGCGCAGGAGGAGCAGGAGCCGGCGCGGCAGGAGTAGGGC
AGGTCGATCCCCTCCTCCTCGGCCTGGTCGAGGATGTAGACGTCGTCGGGGACCTCCAGCTCCACCTCGCCCTCGGGCGTCACCAGCTTCACCTTGTACG
TCGCCTGCGCGCGGAGCCTGGCTCCCCGCACCTGCTTGGCGGCGGCGAGGCTGAGGGCCGCGGGCGCCAGGGCCACGCGGGGCGCCGGTGGCGCCACGGC
GCGCACGGAGAAGGGCGCGCGGAGGCTCAGTGCGGCGGCCATTGGTGGCTAGCTAGCTGGAGCTTGGACGCTCTTTCTCTGTGTGGCTGAGAAGGTGGAG
AGGATCCCGG
page-top