Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6923  (registered. 2012)
Contig Information
Length 699 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|114145396|dbj|BAF30987.1|| dehydrin [Triticum aestivum]
Score 240
Evalue 1.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6923
GCACGAGGCTCACACAACCAGGACAAGCAAGCAGCAGAACCAGTGTCAGATTTCCCGAGGCACAAGTTGAGCGCAAGATGGAGCACCAGGGGCGCGGCGC
AGGCGAGAAGAAGGGCGTCGTGGAGAGCATCACGGAGAAGCTCCCCGGTGGCCACGGTGATCACCAGCAGGCCACCGGTGGCACGTACGGTCAGCAGGGA
CACGCCGGAGTTACCGGCGAGAACATCAAGGAGAAGCTCCCCGGTGGCCACGGTGATCACCAGCAGACCACTGGAATGACCGGCTCGGAGACGCATGCCA
CCACGGCCACCACCGATGGCAACTACGGGAAGTCGGGACACACCGGCACTGACGGCACCGGTGAGAACAAGAGTATCATGGACAAGATCAAGGACAAGCT
GCCTGGACAGCACTAAGCCCAACCGGTCTGCCCGCTACCTTTGCAGAATAATATAATAAGATGGCCAACTTCCACCGTGTATACATGAATCGAGTCTAGT
TCAACTAGCTCACTTGGTCGTACATCTGGGTTTAAGCTTTCATGGACAACAGTGTGTCGAGGGTTTTTGTTTGTTTACAATTTGCATACTTTGATGTGGA
AATTTCCTTTGGTTCAACCGGTGCATGGTATGCTATGGCATCTAATATACATACTCCCTCTGTCCCAAAAAAAAAATCTCAACTTTGCACTAACTTTAG
page-top