Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15791  (registered. 2003)
Contig Information
Length 738 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 4
Homology (BLAST) Top Hit hypothetical protein OsJ_019212 [Oryza sativa (japonica cultivar-group)]
Score 289
Evalue 2.62585e-24
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15791
GGTCTTATTTGAACGCAGCTTTGACATGCCTAGTCTGGAGAAGAAATCTTCCAATACACCTATCAGATCACCAAGCGTCAAACCATAATCACCTCCCTGA
GGCCGTCACCGCAAGGATCAGCATTGAGGCCGGGTCTACCCTCGGATGGCAAAAGTACGTCGGGTCCAAGGGCAAGACCATCGGCATCGACAAGTTCGGC
GCCAGCGCACCTGCCCCGAAGATCTACAAGGAGTACGGCATCACCGCGGAGAACGTCATCGCCGCAGCCAAGAGCCTGTAAGATCAGCACACTCTGCGAG
GTTCTGTCATCGTTGATGCCAAAGAACAAACACCACACTTGTGAAGGTCTCGTGCCCAGAAGCTTTGGAATAACGGAGGGAGAGGAGGATATGCCTGCGT
CGGAGCGTGAGTGGTATTTTTAGGCCTGTAATAAACAATGCCTTTTCCATTTGCGTTGTCTTACATTCGATATATATCGCCCCCCTTAGATGATTCGCGG
AGGGGGCGAGCCTGATCAAATTGGGGACTGGTTTTTTGTATTTGTTTACATCGAACTGATGGTCGTGCTTGCGATGCTTCTTTCTCTCCCCGAGATCGTC
GCCTCCATGGGTTTTATGCTTTGATGCGCCCTTTTAGTCCTTGGTAGTTTGCTCATCTTCCCCTTCCCCCATACAAACGGTTTGATGCATAGTATCATCA
GTGCAATAAACATAGAGTGTTTTCCATCAAAAAAAAAA
page-top