Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15783  (registered. 2003)
Contig Information
Length 1115 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit hypothetical protein OsI_34371 [Oryza sativa Indica Group]
Score 1288
Evalue 7.62884e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15783
GACTGACCGAGATTCAGACATAGTCAGACGCAGGCGTCAGCAGAAGCAGAGCAGCAGGCGATGGCCGGCGGTAGCCTGGACCTCCCCGTGGTTGACCTCG
CATCCCCCGACCTCAAATCCGCCGTGGACGCCGTCCGGAAGGCATGCGTGGAGAGCGGGTTCTTCTACGTCACCAACCACGGGATCCAGGACGGCCTGCT
GGAGGCGTTGTTCGCCGAGAGCAAGAGGTTCTTCGAGCTGCCGCTGGAGGAGAAGATGCTGCTGCAGAGGAACAGCAGCCACCGGGGCTACACCCCGCCC
TACGCCGAGAAGCTGGACGAGTCGTCCGAATTCCAGGGAGACCTCAAGGAGAGTTTCTACATTGGGGCGGTCAGGGATGTAGATATGCCGAATGATCCTA
ACCAATGGCCTCCTAAAGAGCGCTTTCCATCTTGGAAGGATACAATGAAGCTGTACCATGAAGCTGCACTGGCTGCTGGCAAAAGGATACTCTCTCTAAT
TGCTCTGAGTCTGGACCTAGAAGCTGAATTCTTTCAGAAGATTGGTGCAGTCAACTGCTCTTCAGAAGTTATTCGGCTATTGCACTACCCAGGTGAAGTA
AACGAGTCTGATCATGGAAATTATGGTGCATCAGCTCATTCAGATTATGGAATGATAACTCTTCTAGCAACAGATGGCACTCCTGGCTTGCAGATATGCA
GGGAGAAGGATAGGCATCCCCAGCTCTGGGAAGATGTTCGTCATGTTGATGGGACCCTTATTGTTAACATTGGCGATTTGCTAGAAAGGTGGACAAATTG
TGTTTTCAGATCTACACTTCATCGGGTTGTTGCAGTTGGCAGAGAGCGATATTCTGCGGCTTACTTTCTGGACCCAAGACCCGATCTAGTGGTGCAGTGC
TTGGAAAGCTGTTGCTGCGACGCATATCCTCCAAGGTTTCCACCTATCACGGCGGGTGACTATTTGAAAGAACGATTAAGTGCCACATACAAATAACTGA
AGACAGAGTTGTATTTCCTGTAAAATAGCAATGTGTACTATGACTGTAAAGGTAGTTGTATTTCAGTACAGTTGTAACGGTTCTAGTGCATGTCTGACTA
AATCTGTATCGTCAT
page-top