Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15765  (registered. 2003)
Contig Information
Length 1565 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_028000 [Oryza sativa (japonica cultivar-group)]
Score 640
Evalue 3.32257e-122
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15765
CGATTCTCCAATCCCCCGCAGAAAAGGGCGCCAGTGCATCCGCTCCCGTTCCTAGCAGCAATCCGTTACCACCAAGGCGGAAGATTTAGTACTCCTCCTC
GTCTACTTCTTGCTCAGCTCCACCCACACCGAATCTAGCATCGCGGCGGCTTCGTGTTGACTCGTCTGTCCTCCTCCCCGGCTCGGGAGCGCTCGTGGGC
TTCTCGGATCGGCGGCGCGTCCGCTTTCCGTGCTCGGATCCAAGAAACCAGCTGGGAGTTAGGTTCTTGGATTTGGATCTCCCACCCGCAATGGCGGCGC
TCGTGGAGCTCTTCACGAGATCCTACTCGTCCTCCACGCCGGTGGACTGGGAGGCGGAGGCCTACCCGGCGTACGGCGACTACGCCGTGCTTCCCATCCT
TGTCGCCTTCTTTCCCGCCCTGCGCTTCCTCCTCGACCGGTTCGTCTTCGAGATATTAGCAAGAAGGCTTATATTTGGAAAGGGATATGACAAGCTTGCT
GAAACAGACGAAAGGAGAAAGAAAATCAATAAATTTAAGGAGTCCGCCTGGAAATTTGTTTATTTTCTTTCTGCAGAGGTCCTTTCATTATCTGTAACAT
ACAATGAACCATGGTTTACAAACACCAGATACTTCTGGGTAGGGCCTGGTGAGCAGCTCTGGCCCTGATCAAAAGATGAAACTGAAGCTTAAGGCTGTAT
ACATGTATGCTGCTGGATTTTTACACATATTCCATCTTTGCCCTTCTGTTCTGGGAAACAAGACGCAAGGATTTCGGAGTCTCGATGTCTCACCATGTGG
CAACTGTTGTTCTGATTGTTATGTCCTACATTTGCAGATTATCTCGTGCTGGCTCGGTCATTTTAGCCGTCCATGATGCGAGTGATATATTCCTAGAGAT
CGGAAAGATGGCCAAGTATAGTAGCTGTGAGGGGCTAGCTGTTGTAGCATTTCTACTTTTTGTGGCTTCTTGGATCCTTCTTCGGCTAATAATTTTCCCT
TTCTGGATCCTGAGAAGCACAAGCTATGAAGTAGCTGTGATCCTTGACAAGGAGAAAAAAGAATTTTACAGCTCCGTATACTACTATCTTTTCAACAGTC
TCCTGTTCTCACTTCTAGTCCTTCACATATATTGGTGGGTACTGATTTACCGGATGCTAGTGAAACAAATCCAATCCAGAGGACGTGTTGGTGACGATGT
TCGATCCGATTCTGAGGGAGAAGAAGACCACGAAGATTAATCTGTAGGTTGTTGGATGCTTAACTGAAGAATTATATAATGTGTTCCCTACAGGATGATA
CGTCCATCACCATAGGCACTGATTTCACTAGACTGGATCAATCTTCGTGTCAAACATGGCAGCCACAATTTGCAGGAGTTGGTACCACAGCTACTTGTGC
TATCATATACAAAGTTGGTGTATATTTGCCCTGGATCCGTATTTGTATAAAAGAGAGCACAATAAGTTTGTTCAGTCTAGGAAGGATTAGTTGATTCATG
ATGCATTGACGTCGTTGTGTAATATGCAGTGGTAACTCAGTTTGCAATCTTGGTGTATCTGCATG
page-top